Clone Read LE_HBa0098K19_SP6_30852

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0098K19_SP6_30852
Primer
SP6
ID from Seq. Facility
LE_HBa_098_K19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
652 trimmed for vector and quality, 804 raw
Genbank Accession
Sequence
>LE_HBa0098K19_SP6_30852 (raw untrimmed)
GTATTTATTTGAATGCTTTATCAGAATTTAGATATTCAACCTAGAAGAAGAACCTGATTTGGTAACATGTCAAAATAGTATAAAATACTTTGCAAAAGAA
ATGTATGATAAAGATTCATTCTTAGATAATGTTGAAAATCCTCAAACGTCTACGAATCAAGTAGGTGCTCATGGACGAGTGAAACATAAACTTGATCTTG
ACTCTCCTAATAAATGTGAATTTGTTAAATATCTTGAGCAGGGTACAGATGATATTACAAACGATAATGGTATACCGGAACTATTGAACTGGTGGAGAAA
TCGTAGAGCTCAATATCCAAAACTTAGTAGGATGGGGAAGGATGTGCTTGCGATTCAAGGATCATCAGTAGCTTCGGATGCATCTTTCAGCGCGGCAAGA
TTTCAAATTGGAGACCACAGATATTCGTTAGCAGAAGACAGCCTGGAGATATCAGTGTTATTTAGAGACTGGATAAATGATGAGCGTAGAAATCAAGGAC
TTCCAAAGTTAGATAGTCAATTTGAACTTTTCATAGATTCAGCTATTGGATGTGGTAGTGATGATGACATCGAAATTCAAGATCGTCAACGAGCTTTACC
AAGACCAGAAGTTGATCACAATCAATCCCTAGCTGAGTTAGAAAGAGGATTTACGGGACTATACAACTATTAGTATTTACATTCGAGACATAGTTGAAAC
AGAACCCTTTCTATAAGGTGGCTGCCGTAAGCTATGTACTCTACTAAAAAGTTGTAAATTGAAATTTGTAATTTTGTTACAAATTTAAATAAATTTAAAA
TTGA
>LE_HBa0098K19_SP6_30852 (trimmed for quality and cloning vector)
TTTAGATATTCAACCTAGAAGAAGAACCTGATTTGGTAACATGTCAAAATAGTATAAAATACTTTGCAAAAGAAATGTATGATAAAGATTCATTCTTAGA
TAATGTTGAAAATCCTCAAACGTCTACGAATCAAGTAGGTGCTCATGGACGAGTGAAACATAAACTTGATCTTGACTCTCCTAATAAATGTGAATTTGTT
AAATATCTTGAGCAGGGTACAGATGATATTACAAACGATAATGGTATACCGGAACTATTGAACTGGTGGAGAAATCGTAGAGCTCAATATCCAAAACTTA
GTAGGATGGGGAAGGATGTGCTTGCGATTCAAGGATCATCAGTAGCTTCGGATGCATCTTTCAGCGCGGCAAGATTTCAAATTGGAGACCACAGATATTC
GTTAGCAGAAGACAGCCTGGAGATATCAGTGTTATTTAGAGACTGGATAAATGATGAGCGTAGAAATCAAGGACTTCCAAAGTTAGATAGTCAATTTGAA
CTTTTCATAGATTCAGCTATTGGATGTGGTAGTGATGATGACATCGAAATTCAAGATCGTCAACGAGCTTTACCAAGACCAGAAGTTGATCACAATCAAT
CCCTAGCTGAGTTAGAAAGAGGATTTACGGGACTATACAACTATTAGTATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957402
Expected error %
0.375648
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39288.1| Score 116 E Value 4e-25 Identity 15.80% Align. Length 392bp (60.12%) Frame 1
putative transposase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0098K19
Clone
Clone name
hba-98k19
LE_HBa0098K19
P098K19
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found