Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0098O14_SP6_31034

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0098O14_SP6_31034
Primer
SP6
ID from Seq. Facility
LE_HBa_098_O14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
715 trimmed for vector and quality, 821 raw
Genbank Accession
Sequence
>LE_HBa0098O14_SP6_31034 (raw untrimmed)
GTTCCTTTTGCCTTACGGGTTTACTCGCCTGTTGACTGGCACACATGTCAGACTCCTTGGTCCGTGTTTCCCGACGGGTTGAATGGGGAGCCCACAGGCC
AGCATCCGGAGCCTGCAGATACAAGAGCATGCCGGAGGAGCGCGCTACCTTCCACAATCAGGGAGACGGCGTTCCACGGGGGTATCGAGAGCTTGGGCTT
TGGCCGCTCCCCCAATACACACTTGTCCACGCCATGAGTCAATCGGCGGACCAGCTCATCACCATTCCACATCTGACCGGGGCACATCGCCGGCCCCCAT
CCGCTTCAATCCCGACAATTTCAAGAACTCTTTGACTCTATTTTCAAAGTCTTTTTCATTTTTCCCTCGCGGTAATTGTTCGCTATCGGTCTCTCACCAG
CATTCAGCCTTGGACGAAATTCACTGCTCGATTTAAGCTGCATTCGTAACCCGACTCGTAGATAGCACCTCGTGGTGAGACAAGGTCCGGGCACGACAGG
GATCTCACCATCTCCGGCGCCCCCTTCCAAGGGACTTAGGCCCGGTCTTCCGCTAAGGACGCTTCTCTAGACTACAATTCGAAAGACGGATCCGCCCGAT
TCTAAGGCTGGGCTATTCCTTGTTCGCTCGCTGTTACTAGGGTAATCCTTGTAAGTTTCTTTTTCTCCGCTTATTGTTATGCTTAAACTTAGCGTGTAAT
CCCGCCTGACCTTGGGTCACAGTCAGAGCGCCTGGTGAGACGCAGTAAAGGTCGGGGAGTCCGGACGCCCCGACAGAACTGTAGCCTTGACAACAAGAGA
AGAGTTAAGTTTTCACCCGCC
>LE_HBa0098O14_SP6_31034 (trimmed for quality and cloning vector)
CGGGTTTACTCGCCTGTTGACTGGCACACATGTCAGACTCCTTGGTCCGTGTTTCCCGACGGGTTGAATGGGGAGCCCACAGGCCAGCATCCGGAGCCTG
CAGATACAAGAGCATGCCGGAGGAGCGCGCTACCTTCCACAATCAGGGAGACGGCGTTCCACGGGGGTATCGAGAGCTTGGGCTTTGGCCGCTCCCCCAA
TACACACTTGTCCACGCCATGAGTCAATCGGCGGACCAGCTCATCACCATTCCACATCTGACCGGGGCACATCGCCGGCCCCCATCCGCTTCAATCCCGA
CAATTTCAAGAACTCTTTGACTCTATTTTCAAAGTCTTTTTCATTTTTCCCTCGCGGTAATTGTTCGCTATCGGTCTCTCACCAGCATTCAGCCTTGGAC
GAAATTCACTGCTCGATTTAAGCTGCATTCGTAACCCGACTCGTAGATAGCACCTCGTGGTGAGACAAGGTCCGGGCACGACAGGGATCTCACCATCTCC
GGCGCCCCCTTCCAAGGGACTTAGGCCCGGTCTTCCGCTAAGGACGCTTCTCTAGACTACAATTCGAAAGACGGATCCGCCCGATTCTAAGGCTGGGCTA
TTCCTTGTTCGCTCGCTGTTACTAGGGTAATCCTTGTAAGTTTCTTTTTCTCCGCTTATTGTTATGCTTAAACTTAGCGTGTAATCCCGCCTGACCTTGG
GTCACAGTCAGAGCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.982992
Expected error %
0.178782
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_467300.1| Score 76 E Value 7e-13 Identity 19.20% Align. Length 233bp (32.59%) Frame 1
hypothetical protein [Oryza sativa (japonica cultivar-group)] dbj|BAD07869.1| hypothetical protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD46202.1| Score 60 E Value 1e-16 Identity 45.20% Align. Length 360bp (50.35%) Frame 1
hypothetical protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0098O14
Clone
Clone name
hba-98o14
LE_HBa0098O14
C02HBa0098O14
P098O14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found