Clone Read SL_EcoRI0099C11_SP6_310760

Sequence Read 
Read Class
BAC ends
Read ID
SL_EcoRI0099C11_SP6_310760
Primer
SP6
ID from Seq. Facility
SL_EcoRI_099_C11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
738 trimmed for vector and quality, 965 raw
Sequence
>SL_EcoRI0099C11_SP6_310760 (raw untrimmed)
NNNCAGTGTGCGCGGTCGATCTGAGGATCCCCGGGNACCGAGCTCGAATTCATAATTCAAAATTCAAGGCATTGTTGAGAGTTAAGTTTTGAGAATTCTT
TCGAACGTTCTAAGAAAGTCCTTTTGAGGAGTCATCCACAACTTCTAGTAACTTGTTTAAAGATTCAAGCAAGTGATTATAAGAGTGAAGAGTATGTATT
TATGAGTCTACAATATCCGCTATATCCTACTTATCATGAACCATAACTCTTGAATTCATAATTCATATTCAAGAGAGAGTAAATAGTTGATTTTAACAAA
GATTTTAAGTTAAATCATGAATCTTTTTAGATCAACTATTAAGATTGACTGATATTCGAGAAACTAAGTAAGAGAATGAGAAATGTTGTATTCATGAGTT
CTATATAGCTACATAGACCTTAGAGTCAAGTCATTCATGCCCATAATATCCGCATGAGTTTCATAATTTGAGTATTATTAAGAGTAGTATCTCTAAGTTC
TATGTTGTGAGTATTGAGTTCATTTTTCCTATCTTGAGTTAAAAAGAACCTTCTAGTTCTTGGGTTGAGTAGTTCATGCTCATAATTCCGCATGAACTCT
CCAAGTTAAAAATCATGAAATAATTCATAAACATTAGATCATAATCCTTGAATCAATACTTCAATTCAAGCAAAGTTAAGATCAATGTGAAGGAAGCTAA
GAGTCAAGTCTTGAAGAATACAAGGCAGTCAAAGTAAAGTTATAAAGTTTTGTAGAGTCTTTCACAAACATTTTCACTTCATTTTAAAAGACTTTAATTT
CAAGTCCGGGGAGAACAAAGAGTTGAAGTCATTTTCTCAAAGCTATTAAGGACCTAAATATCCCATAAGAGTTAAGTTTTGAGTAGCCAAGAGTATCAGG
TTGAGTTCCCTTCTCAGAATTCCAGGGAACTAAGTGGTACCTAAAAATGTAAGAAAAATGATTTT
>SL_EcoRI0099C11_SP6_310760 (trimmed for quality and cloning vector)
CATAATTCAAAATTCAAGGCATTGTTGAGAGTTAAGTTTTGAGAATTCTTTCGAACGTTCTAAGAAAGTCCTTTTGAGGAGTCATCCACAACTTCTAGTA
ACTTGTTTAAAGATTCAAGCAAGTGATTATAAGAGTGAAGAGTATGTATTTATGAGTCTACAATATCCGCTATATCCTACTTATCATGAACCATAACTCT
TGAATTCATAATTCATATTCAAGAGAGAGTAAATAGTTGATTTTAACAAAGATTTTAAGTTAAATCATGAATCTTTTTAGATCAACTATTAAGATTGACT
GATATTCGAGAAACTAAGTAAGAGAATGAGAAATGTTGTATTCATGAGTTCTATATAGCTACATAGACCTTAGAGTCAAGTCATTCATGCCCATAATATC
CGCATGAGTTTCATAATTTGAGTATTATTAAGAGTAGTATCTCTAAGTTCTATGTTGTGAGTATTGAGTTCATTTTTCCTATCTTGAGTTAAAAAGAACC
TTCTAGTTCTTGGGTTGAGTAGTTCATGCTCATAATTCCGCATGAACTCTCCAAGTTAAAAATCATGAAATAATTCATAAACATTAGATCATAATCCTTG
AATCAATACTTCAATTCAAGCAAAGTTAAGATCAATGTGAAGGAAGCTAAGAGTCAAGTCTTGAAGAATACAAGGCAGTCAAAGTAAAGTTATAAAGTTT
TGTAGAGTCTTTCACAAACATTTTCACTTCATTTTAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
3' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.915325
Expected error %
0.671339
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone SL_EcoRI0099C11
Clone
Clone name
sle-99c11
SL_EcoRI0099C11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato EcoRI BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
EcoRI

Other Reads:
1 sequencing reads found