Clone Read SL_EcoRI0099C11_T7_310761

Sequence Read 
Read Class
BAC ends
Read ID
SL_EcoRI0099C11_T7_310761
Primer
T7
ID from Seq. Facility
SL_EcoRI_099_C11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
2 trimmed for vector and quality, 1354 raw
Sequence
>SL_EcoRI0099C11_T7_310761 (raw untrimmed)
GCGAGTACTTCTGCATCTACTTGGAGGTAGCATACTGATATTAACAGTCGCACCTGCCCGTATTTGATACTTGATAGTGACAGGCATGCCTCTCCTTGAC
TCTATAGAGCACAACTACTTTTCTGGTCTCTGGT
CACCACACGTATTTCCACTTCCACTCTTCTTATTACTTGTGTCACTCATAGAAGACCTCACTAGCA
GGCGGCGGCAGATATGTAGGTTTAGGCTCAAAGCCCTGATGTTGTATGCTGCAAGGTGAGCATAACCTGTCCCTCTGTACTACATATTGGAGCTAAGATA
TTCATTATACGTCGAGCTGTATGCATAAAATACTTCCCGCACAGACGATACTACGGCGGACAATTTCTACGTGCTGCTCAGTTAACTTCGCGGACCCGCT
CTCGTATATCCACCTCTATGGTGCTAGTCGAAACGTCCACCGAATCGCTATTGCTATATGATGGCGAGTCCTATATGTATATACTCTACCGAGATTTCAC
GTAGTCGTATCCTAGAGCGGCATTTATATGAAGCACCTATCCCGCCTCGATCCTGTGCGTCGTCTTCAAACTTCGACCGCACAATCTTATATTTATGCAA
CTCTTCCACTTCTATCTGCTTGCACCGCATCGCCTATATGCATACCTTGAGCCTGAGTTGTGTGTGTGAAAAATATCAACTTGCGCGATCGTATCTAGAT
TTTCATCTGCTCTACGTTGCCTATACACACGTATACTAATATGTTTGTAGTACTATCATCTACTCCTACTTGCTACCGACGACTAACTATATACCATAGT
CATCCTCTATACATATCATAGTATCTGAGATAGATTTCTCACTGCATCGCCTTTGCCTAAATCAAACTTGTCCGTTACCCCCTGCTATCGCTGACAAATG
ATGTGACGTGTCGAACACTGTACGACTTGCTACNTGCTGTTTATCACTATAGATTATTTGCTGGTAACTTTCTTATCCATATCAGCTTATGTATCGTATA
CTTCGCTCATGCACGACTGCTTAGTCAAATCCACTACCATCTCGATATACGACTACTCTCTACCTTATTCACTCAGATTATAATTATACATGACAGACAC
CCAAACCTTCTCTACGTTTCTCATAGAGTTCTTCGTTCTCGTTACCGGTTCGTTTTCTTTCTGTGACTCATTAGGTCTCTGCCCCTTTCTCTTCTCTGCG
TACTTATATTATCTCTGTATCAACGTCTCATTTTGACGTATATCACCATTCTCTTTCATCTCTATCTCACTACTCTCAAACGCCCTAGAATGCGTAACGC
AACCATCTTCTTTCGACCTCCTCTTTTCCTACGCCCTCGCTCTTACGCTCTACG
>SL_EcoRI0099C11_T7_310761 (trimmed for quality and cloning vector)
CA

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.897164
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone SL_EcoRI0099C11
Clone
Clone name
sle-99c11
SL_EcoRI0099C11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato EcoRI BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
EcoRI

Other Reads:
1 sequencing reads found