Clone Read LE_HBa0099H05_SP6_31448

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0099H05_SP6_31448
Primer
SP6
ID from Seq. Facility
LE_HBa_099_H05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
576 trimmed for vector and quality, 844 raw
Sequence
>LE_HBa0099H05_SP6_31448 (raw untrimmed)
CGGTTTTTTTCTTTTAGGAGGTTACTCTTTACACTTCGGCATAGCTGGGTAAGACCATTTGGAGCAGGCTGCAGAGCTATAATGAGTGACTGTTACATCA
ACCAAACTGTTCCTTCTTTTTATTCTCTCTTTCAACAAAAATTGAGCATACCATTTAACATCACATAACAAAAGAAACTACCAATGCTAAAATTAGGAAT
TTAGGATGATACGTATATAAGAATTCATAAGAACAACATATTTACACAAGGAACAAACAACTAACAGTAGGAGTTGAATTTGATGTCGCAGCAAACAAGA
TAGAGAGTTCATCACATGAGGAGGATCAGTCCCTATGGGTTGGATCCGAGCTCATACCTGGTAATTAGTGTTCCCAATCATGCAATATTCATGCATTATC
CATTGTGTCCTCTGTCCTTTAGGTGCCCGACCAGTGTGGAACACCAGTGTTCTCTTTGTGCCAATGATATTCGAATTAGACTTCACATTACGTTCTTTTC
CTGTGGCCTTCCAGTAACCAGATTCAGTTGCCCTTTTACTTTGTGATCCGTTCGGGTACTTCCTTCCACGAGGAGAAAAGAAGAACCATTCATTATCTGA
TTGAATGACGGATTTAGCTGTTACATGTGAAGAATGATTGATCAATTAATTGAACAAGTTATGTAGGGTTGAGTTACTACCTCACAGAGTAACTAATTAA
AAAAGTCAAATGAAAAAGGATAATGTGATGCCTCCTCATCCTTTTCCTACCTCCTTTTAAAAAAAATTTAAATTGAATAAACTATTTACTACCGTAAAAT
CCCATATTTATAGTGAATGGGGTTCTCTTTCTTATATTCTTTTT
>LE_HBa0099H05_SP6_31448 (trimmed for quality and cloning vector)
TAAGACCATTTGGAGCAGGCTGCAGAGCTATAATGAGTGACTGTTACATCAACCAAACTGTTCCTTCTTTTTATTCTCTCTTTCAACAAAAATTGAGCAT
ACCATTTAACATCACATAACAAAAGAAACTACCAATGCTAAAATTAGGAATTTAGGATGATACGTATATAAGAATTCATAAGAACAACATATTTACACAA
GGAACAAACAACTAACAGTAGGAGTTGAATTTGATGTCGCAGCAAACAAGATAGAGAGTTCATCACATGAGGAGGATCAGTCCCTATGGGTTGGATCCGA
GCTCATACCTGGTAATTAGTGTTCCCAATCATGCAATATTCATGCATTATCCATTGTGTCCTCTGTCCTTTAGGTGCCCGACCAGTGTGGAACACCAGTG
TTCTCTTTGTGCCAATGATATTCGAATTAGACTTCACATTACGTTCTTTTCCTGTGGCCTTCCAGTAACCAGATTCAGTTGCCCTTTTACTTTGTGATCC
GTTCGGGTACTTCCTTCCACGAGGAGAAAAGAAGAACCATTCATTATCTGATTGAATGACGGATTTAGCTGTTACA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968997
Expected error %
0.13493
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g44290.1 Score 144 E Value 3e-35 Identity 25.50% Align. Length 242bp (42.01%) Frame 1
68416.m04756 no apical meristem (NAM) family protein contains Pfam PF02365: No apical meristem (NAM) domain; NAC2 - Arabidopsis thaliana, EMBL:AF201456
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g22290.1 Score 140 E Value 5e-34 Identity 24.70% Align. Length 242bp (42.01%) Frame 1
68418.m02599 no apical meristem (NAM) family protein contains Pfam PF02365: No apical meristem (NAM) domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB88997.1| Score 144 E Value 1e-33 Identity 25.50% Align. Length 242bp (42.01%) Frame 1
putative protein [Arabidopsis thaliana] ref|NP_190015.1| no apical meristem (NAM) family protein [Arabidopsis thaliana] pir||T49145 hypothetical protein T10D17.80 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB08327.1| Score 140 E Value 2e-32 Identity 24.70% Align. Length 242bp (42.01%) Frame 1
NAM (no apical meristem)-like protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0099H05
Clone
Clone name
hba-99h5
LE_HBa0099H05
C06HBa0099H05
P099H05
Clone type
BAC
Contamination
none
Estimated length
166,487
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found