Clone Read LE_HBa0099H05_T7_31449

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0099H05_T7_31449
Primer
T7
ID from Seq. Facility
LE_HBa_099_H05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
420 trimmed for vector and quality, 763 raw
Sequence
>LE_HBa0099H05_T7_31449 (raw untrimmed)
TAAGAAAGTTGATTGATCACATAAAACTAAAGCACGGCGTACCCACTCAAAATAAACGTTATTCTAAAAACGTAAAACAAAACAAAGTTCTTGACCGGAT
TGTGCTTGAAGTTTCGGTGGTGAGGCTTGGTTTCGTGGGAAGTTGGCAACATTTAAACAAGTGTGGAACGACATTAAGGTATGAGTTTTCATACTCTTGG
TCCCTTTCCCAAGAGACCCTTAAGACTCAATAATTCTATTCCGAAACTAGGATTGTTCCCCATTACATATTCACTATCACTAACTCCTATCGCTGATCTT
AGGTTTGTATGTTTGCTGGTAGATTAGGTATGAGGTGTGATTTTTGTGATAATGTGTTCATGATTGTATAAAGGATGAAGTATGTCTGCCAAAATTTTGT
GAAAAATGTATCTGTATGCCGTGACATGATTTTCGGTTTTAAGCCTTAAAAATGATATGTTTTTTTGGTTGATTTTTATGTGTGAATAGTTGTGTAAATT
ATGAGGCGTAAAAGTGGTGCAATGTTGCTTGATTTGATGGTATTCTTCGGCTGAATATAAGTCTGAGAAGGTTACACTTTAAGATGCACCAATGATCCAC
ATATGCCTCATGATTTTCTTATGAATGATGATAACTAGACGCTAATAATCTACAATTCCATCATCGGTTGTTCGCTCCTCCCTACCTGTCTATCATCTCT
CATTCTATCTTTCAATTGATTCTACCGTTCATTTCATTATTCTCACTCTCTCTTCTTCTCCTT
>LE_HBa0099H05_T7_31449 (trimmed for quality and cloning vector)
TAAAAACGTAAAACAAAACAAAGTTCTTGACCGGATTGTGCTTGAAGTTTCGGTGGTGAGGCTTGGTTTCGTGGGAAGTTGGCAACATTTAAACAAGTGT
GGAACGACATTAAGGTATGAGTTTTCATACTCTTGGTCCCTTTCCCAAGAGACCCTTAAGACTCAATAATTCTATTCCGAAACTAGGATTGTTCCCCATT
ACATATTCACTATCACTAACTCCTATCGCTGATCTTAGGTTTGTATGTTTGCTGGTAGATTAGGTATGAGGTGTGATTTTTGTGATAATGTGTTCATGAT
TGTATAAAGGATGAAGTATGTCTGCCAAAATTTTGTGAAAAATGTATCTGTATGCCGTGACATGATTTTCGGTTTTAAGCCTTAAAAATGATATGTTTTT
TTGGTTGATTTTTATGTGTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944143
Expected error %
0.41358
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0099H05
Clone
Clone name
hba-99h5
LE_HBa0099H05
C06HBa0099H05
P099H05
Clone type
BAC
Contamination
none
Estimated length
166,487
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found