Clone Read LE_HBa0099K07_T7_31597

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0099K07_T7_31597
Primer
T7
ID from Seq. Facility
LE_HBa_099_K07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
861 trimmed for vector and quality, 909 raw
Sequence
>LE_HBa0099K07_T7_31597 (raw untrimmed)
CCAACCGGGGTACCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATACAAACACACAAATGGCATACAGTTCCTACAGAATACACCCAAC
AATATATGCAACAAGGACCTCTTGTTTGCACCAAAAGTTAACCAGCAAGAAGTGGGATTACATCTCAATGATATATAATAAAGATATTTCATACTTCAAT
AGCACTCATTAAAATGAATTATAATGCATGTAATATAGAAAAAGTAGATTACAACACAAGCTAATCAACATCTTGACAACCAAAATTAGAATCCAAAAGA
AAGCTAACCTTCATCAAAACATCTAAGCAATACATATGAGGCCAGGGCTTACCTTTCTTTCCTGAATTGATGTATTTATCAATAATATCTGCCCCCTCTT
TTGAAATTGAAACAACAGGAATGGTTACATTTGATATGGTAGAATTATTAGGACAAGCAATATCCAGAGTACCTAAATAAATGCAAGAAAAAGCGGCGTC
ATATCAGAAAGAGATGAAGGGAAACATATAAAAGAGACCTTGAGACCTAAGATGACAATGTGAGTCAGGGTTACAACCTCCTTCATTATTTATTAGCACA
ACACCTCCTGCACCTCCTGCTTGGGCGACCGTGGCCTTGGTTATAAATTCACATTCACCGCGACGAGCTAGTGCAATAGAGCCTGATAACTAGAACAAAT
GATATTTCTGCATTATTAATGTATAACAAACAACAACACTATTATTTTCTTTTTATAGGACATTCTCGAGCCTATTTTTACAACAGCCAAACAGACATAG
CAAATTTAGACTTCTTTGGTATTCAAAGTAAAACTCAGTTTGTAATAGTTAACTTCTGGTAGATCCTAGTGGTAACCCTTTCAGCTCATTTTACAATTTG
AAATTACTC
>LE_HBa0099K07_T7_31597 (trimmed for quality and cloning vector)
AGCTTTATACAAACACACAAATGGCATACAGTTCCTACAGAATACACCCAACAATATATGCAACAAGGACCTCTTGTTTGCACCAAAAGTTAACCAGCAA
GAAGTGGGATTACATCTCAATGATATATAATAAAGATATTTCATACTTCAATAGCACTCATTAAAATGAATTATAATGCATGTAATATAGAAAAAGTAGA
TTACAACACAAGCTAATCAACATCTTGACAACCAAAATTAGAATCCAAAAGAAAGCTAACCTTCATCAAAACATCTAAGCAATACATATGAGGCCAGGGC
TTACCTTTCTTTCCTGAATTGATGTATTTATCAATAATATCTGCCCCCTCTTTTGAAATTGAAACAACAGGAATGGTTACATTTGATATGGTAGAATTAT
TAGGACAAGCAATATCCAGAGTACCTAAATAAATGCAAGAAAAAGCGGCGTCATATCAGAAAGAGATGAAGGGAAACATATAAAAGAGACCTTGAGACCT
AAGATGACAATGTGAGTCAGGGTTACAACCTCCTTCATTATTTATTAGCACAACACCTCCTGCACCTCCTGCTTGGGCGACCGTGGCCTTGGTTATAAAT
TCACATTCACCGCGACGAGCTAGTGCAATAGAGCCTGATAACTAGAACAAATGATATTTCTGCATTATTAATGTATAACAAACAACAACACTATTATTTT
CTTTTTATAGGACATTCTCGAGCCTATTTTTACAACAGCCAAACAGACATAGCAAATTTAGACTTCTTTGGTATTCAAAGTAAAACTCAGTTTGTAATAG
TTAACTTCTGGTAGATCCTAGTGGTAACCCTTTCAGCTCATTTTACAATTTGAAATTACTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.949883
Expected error %
0.567772
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0099K07
Clone
Clone name
hba-99k7
LE_HBa0099K07
P099K07
Clone type
BAC
Contamination
none
Estimated length
82,065
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found