Clone Read LE_HBa0099L02_SP6_31634

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0099L02_SP6_31634
Primer
SP6
ID from Seq. Facility
LE_HBa_099_L02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
653 trimmed for vector and quality, 844 raw
Sequence
>LE_HBa0099L02_SP6_31634 (raw untrimmed)
GGGGCCAAGTTTAAATAGTTTGGAAACAACTTTAGTTTCGTTAAAAAAAAAGGCAATAACAAACTCAAATTTACTCATACCACAAAGTAATATAATTTCT
ATGGGAGATTCTCTAACCCACAACCATCCATTATAAGCCTAAGTGGTGATACCACATCTTCCCGAAACTGTCTGAACTGTTCTATACTTTTCAGTCATAT
AGAACTACCTAACTTAGTGGATCCACTAGCTTATGCTAAAAGCATCTTAAGGAGTCATAAAATTATGATCTTTCACTACTCACGATGGCGACATGGTTTA
TGGAGACTTGACTTATCATGAACTCGCATCACCATACTGGTGCTCAATACTACTCCAAAAATATACTTACCCCATGTGTTTGTAAAAACAAAACTTTTTC
TTTGATCTGAGATAATTACTCAAAACTTAGCTTAAAATCTCTCTTATAAATAATGTTCTTTTCCTTTATTAAATGTGAAAACATTTTAAAATTCTTGAGA
ATACTTAGTTCTCATATACTTCTTTGAAGATATCAACTTCAAATCTTTACTCTTTGCTTAAGTTGGAACTTAAGGCTTAAAATAAAGTAAAAACGTTGTA
AAGACTANNNNNTACTTTATAAACATCTATAGAGTAGCTTCTTATCTTCTAAACATGACTCAACTCTCCTTGATTTGAATCCATGGATTCAAGGATTATG
ATTTGTGATGGAAAAGATCTCATGATATTTAGGGAATGAATTTAGATAGCTAAACATCAGGAAAAAAAATTTATCAATATTTGAGGGTGGGTTCCCCGAC
CGCAAAGCAGCATTTATGTTTTGTGGTCGGATATAATTTTTTAA
>LE_HBa0099L02_SP6_31634 (trimmed for quality and cloning vector)
ACTCAAATTTACTCATACCACAAAGTAATATAATTTCTATGGGAGATTCTCTAACCCACAACCATCCATTATAAGCCTAAGTGGTGATACCACATCTTCC
CGAAACTGTCTGAACTGTTCTATACTTTTCAGTCATATAGAACTACCTAACTTAGTGGATCCACTAGCTTATGCTAAAAGCATCTTAAGGAGTCATAAAA
TTATGATCTTTCACTACTCACGATGGCGACATGGTTTATGGAGACTTGACTTATCATGAACTCGCATCACCATACTGGTGCTCAATACTACTCCAAAAAT
ATACTTACCCCATGTGTTTGTAAAAACAAAACTTTTTCTTTGATCTGAGATAATTACTCAAAACTTAGCTTAAAATCTCTCTTATAAATAATGTTCTTTT
CCTTTATTAAATGTGAAAACATTTTAAAATTCTTGAGAATACTTAGTTCTCATATACTTCTTTGAAGATATCAACTTCAAATCTTTACTCTTTGCTTAAG
TTGGAACTTAAGGCTTAAAATAAAGTAAAAACGTTGTAAAGACTANNNNNTACTTTATAAACATCTATAGAGTAGCTTCTTATCTTCTAAACATGACTCA
ACTCTCCTTGATTTGAATCCATGGATTCAAGGATTATGATTTGTGATGGAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945462
Expected error %
2.10458
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0099L02
Clone
Clone name
hba-99l2
LE_HBa0099L02
P099L02
Clone type
BAC
Contamination
none
Estimated length
124,992
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found