Clone Read LE_HBa0008C01_SP6_3168

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008C01_SP6_3168
Primer
SP6
ID from Seq. Facility
LE_HBa_008_C01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
672 trimmed for vector and quality, 970 raw
Genbank Accession
Sequence
>LE_HBa0008C01_SP6_3168 (raw untrimmed)
CGGGGCTAATCGTCATTCATGTGTCAAAGACGAGAGGTCAAAGTTAGATGCCAAGAGAAGGCAACATCTTCATTGCATTTGAGGTTGATGAATTTGGTTA
CAGGCTATATGATTCAACTTAAAAGAAACTTGTGAGAATCTAGAATCTTCAAGTTTTGATGGTATAGTTCATCAAAACTTTGACTTCTCATCATTCAACA
CATGTACAAAAGCTTTGCAACTAAATATTCTAAAATGGTCATAGGAAACATCCTTTCTATACAAAACACTATTTGGTACATCACTTTGCAAAGCAACAAC
AGGAGATAGATTAATAACATGTGCAGCGGTCAATAAAGCCTCACCCCAAAATGATTTTGGCAACTTTCCTTCAAAAAGCAAAGATCTAACTCTTTCCATC
AAGTTCGTGTTCATCCTCTCAGCCAAACCATTAGGCTGAGGAGTCTTGGGAGGAGTCTTTTGGTGTCTAATACCTTGATTCTTACAGTATTCGTCAAATG
GTCCACAATACTCACCACCATTATCAGTACGAATACATTTAACTTTTTTTCCAGTTTCTCTTTCAACTGAAGCCTGAAACTGCTTAAAGACACCTAACAC
TTGGTCTTTAGTCTTCAATACATAGACGAAAAGTTTTCTCGATCAATCATCAACGAAAGTGACAAAGTAAAGTGCACCCCCCAATGTCTTTATCTTCATT
GGACCACATAAATCAGAGTGCACTTACTCAAGCCACTCTGTCTTTCTCCAAAGAGGGTAGGAATTAAAAGAAACTCTATTTTGGTTACCCACCAAGCAGT
GCTTCAATTTTTCTAATTAGCACTTAAAAATTTGACAATAACTTCTTTTGGCTTAAAAATTAATCCCTTCTCCCTAATGGGGTAACCCCTTGTGCATAAA
GTAAAAAGCTATCCTTTCAATGCTTTCCCACTCAACCCAGTAAAGGGGAGTCTATATAAACACAACTCCT
>LE_HBa0008C01_SP6_3168 (trimmed for quality and cloning vector)
AGACGAGAGGTCAAAGTTAGATGCCAAGAGAAGGCAACATCTTCATTGCATTTGAGGTTGATGAATTTGGTTACAGGCTATATGATTCAACTTAAAAGAA
ACTTGTGAGAATCTAGAATCTTCAAGTTTTGATGGTATAGTTCATCAAAACTTTGACTTCTCATCATTCAACACATGTACAAAAGCTTTGCAACTAAATA
TTCTAAAATGGTCATAGGAAACATCCTTTCTATACAAAACACTATTTGGTACATCACTTTGCAAAGCAACAACAGGAGATAGATTAATAACATGTGCAGC
GGTCAATAAAGCCTCACCCCAAAATGATTTTGGCAACTTTCCTTCAAAAAGCAAAGATCTAACTCTTTCCATCAAGTTCGTGTTCATCCTCTCAGCCAAA
CCATTAGGCTGAGGAGTCTTGGGAGGAGTCTTTTGGTGTCTAATACCTTGATTCTTACAGTATTCGTCAAATGGTCCACAATACTCACCACCATTATCAG
TACGAATACATTTAACTTTTTTTCCAGTTTCTCTTTCAACTGAAGCCTGAAACTGCTTAAAGACACCTAACACTTGGTCTTTAGTCTTCAATACATAGAC
GAAAAGTTTTCTCGATCAATCATCAACGAAAGTGACAAAGTAAAGTGCACCCCCCAATGTCTTTATCTTCAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953966
Expected error %
0.415319
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 266 E Value 3e-70 Identity 23.90% Align. Length 521bp (77.53%) Frame 2
hypothetical retrotransposon [Ipomoea batatas]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02206 Score 241 E Value 2e-62 Identity 22.80% Align. Length 512bp (76.19%) Frame 2
hypothetical protein - common tobacco retrotransposon Tto1 dbj|BAA11674.1| ORF(AA 1-1338) [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008C01
Clone
Clone name
hba-8c1
LE_HBa0008C01
P008C01
Clone type
BAC
Contamination
none
Estimated length
120,045
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found