Clone Read LE_HBa0008C01_T7_3169

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008C01_T7_3169
Primer
T7
ID from Seq. Facility
LE_HBa_008_C01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
809 trimmed for vector and quality, 971 raw
Genbank Accession
Sequence
>LE_HBa0008C01_T7_3169 (raw untrimmed)
CCAGCCTGGGACCCCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTAGACTTAGTTTTCTATTCCAATTCGGAGGTGAAATATGCTCTTCT
TCATTAACCATATAAGCCCACCTAGGAGTACTCATCTCCCTTTGCTTTTCTTTCGAGACCTCATGAGCTGAGGTATTCAATGTGCCCATGGGTGACTTGA
TCATTGAATTGGGTTTGAGCGACATGGCAGCATCACTTTCTTCACTAATCTTAGATACTTCACGATTAGAGATATATGTAGGACCCATAACACTATCGTT
ATTTCAGTCTGCATGCTACATACTCCAATTGGTGTGCTAACTAATTGTATATTATTATTATTAAAATCGGCTCGAAATAAAGTTTGCTAAATCTTGGGAT
TAGAATCAACTAACTATAATTCTTTCTCCACCTCAAGTGCTTCAAATGGATTTGTACAAACAATGTCATTCAGTTCATTAGATTGCGCTAGTAGATTAGT
AGTTAGCTATTGCTTATTTTCACGACGTGGATATTTCCTTCAACTTGCCGAGGAACTAATCCACATAGACATTGATTTTTTTTGTGCAATTGTATTCTGA
TTCCCAGTTGCATTCTAATCACGACCGAAAATTTCAACCTGCAAATCGACAGGTTCAAAAGGTTGCAAATCACCTATTTATGATCCTTCAAATTTTTTGT
CATCAATGGCCAAATTCTCAAGTTGCACATCAGATTTTTGGCGTCTGTATAGCATCGTGAAGTTTCTCAACAGTATGCTTATTCACTTGCCCTATATTTG
AATTTTCCCAACAACTCCGTTCTCTTTTATCTTGTTAATTTTTGCCCAAATTCTGCATCATTTGATTTATTTGTATCCCAACCAGTTTCCCTTCAAATTA
TAACCCCTCACCGAATTCCAACTTGTTTATTGGGAAAAAATTTCTCTTAAACCACCAAACCTGAAAAATTT
>LE_HBa0008C01_T7_3169 (trimmed for quality and cloning vector)
AGCTTGTAGACTTAGTTTTCTATTCCAATTCGGAGGTGAAATATGCTCTTCTTCATTAACCATATAAGCCCACCTAGGAGTACTCATCTCCCTTTGCTTT
TCTTTCGAGACCTCATGAGCTGAGGTATTCAATGTGCCCATGGGTGACTTGATCATTGAATTGGGTTTGAGCGACATGGCAGCATCACTTTCTTCACTAA
TCTTAGATACTTCACGATTAGAGATATATGTAGGACCCATAACACTATCGTTATTTCAGTCTGCATGCTACATACTCCAATTGGTGTGCTAACTAATTGT
ATATTATTATTATTAAAATCGGCTCGAAATAAAGTTTGCTAAATCTTGGGATTAGAATCAACTAACTATAATTCTTTCTCCACCTCAAGTGCTTCAAATG
GATTTGTACAAACAATGTCATTCAGTTCATTAGATTGCGCTAGTAGATTAGTAGTTAGCTATTGCTTATTTTCACGACGTGGATATTTCCTTCAACTTGC
CGAGGAACTAATCCACATAGACATTGATTTTTTTTGTGCAATTGTATTCTGATTCCCAGTTGCATTCTAATCACGACCGAAAATTTCAACCTGCAAATCG
ACAGGTTCAAAAGGTTGCAAATCACCTATTTATGATCCTTCAAATTTTTTGTCATCAATGGCCAAATTCTCAAGTTGCACATCAGATTTTTGGCGTCTGT
ATAGCATCGTGAAGTTTCTCAACAGTATGCTTATTCACTTGCCCTATATTTGAATTTTCCCAACAACTCCGTTCTCTTTTATCTTGTTAATTTTTGCCCA
AATTCTGCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.958221
Expected error %
1.5213
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008C01
Clone
Clone name
hba-8c1
LE_HBa0008C01
P008C01
Clone type
BAC
Contamination
none
Estimated length
120,045
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found