Clone Read LE_HBa0008C04_SP6_3174

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008C04_SP6_3174
Primer
SP6
ID from Seq. Facility
LE_HBa_008_C04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
691 trimmed for vector and quality, 993 raw
Genbank Accession
Sequence
>LE_HBa0008C04_SP6_3174 (raw untrimmed)
AAAAAAAAGAGGTTCCGTNTAGCTATTGACTACTTCNTCACTTCTGCAGCTGTTAATCAGCTCTCTGATATCATCCTTAAGGATGTACCGTTAAGGGCTA
ATGTGCAAATTTCGTTTGATAACACTATTCCTTGCGGTTCTCCGGGTGATTTTTCTGTGGCAGCAATAGCTGGAATCTCCGCTATCTTGGATCATCGAAG
TTCAGCTTTGTCTGTTATTACTGATGCTATTGCTGCCTTGTCCTGCGAGGCCTTGGGGGCTGACATTTCAGCTTTCAATTTGAATGATTCCGGTGATGGT
TCATCTGCCAAGGACGTTGTTGCCGTGGCTTCTGACTTGAAGATCTTGCTTAACGGTTCTAAATTTGTTAACCGTGAGGGTGATGAACCTGCAGTTTCTG
GTGTTCCCGTGGTGCACGGCAAGTTTAGGGAGATTTCCCGACTCCTGCACTCCAGCACCCGTGTCCAATTGAACTCTGCAACTGTATCCAATTCTGGATC
TTCTGGTACAGCCAGCTCCATGTGCACCACGCTGTTTTCCTTGGCTGTGGCCCTCAAGGATTTGGGTAACATCAGTTATAACCGAGCAAAGCGCATTGTC
GATTCTCGCATTACTGGAGATGATGAATTTCCTGCAATGCTGATAAAAGAATGTCCTCGCCCTGATCAGCTAAAAGCTCTTTTCGCATCTTTGGTGTCAG
CTCACTCGGATGAGGAATATGTTAAGTTCTCACATGATGTCAGCTCTTTACTGGTGATGGTAAAGAAAATAATTTCCTGGGGAAGCCTGGCTGCTTTCCT
TTTCCCTGGAGGAAGGGACTTTATTCCTTCCGGCGATCAAAGTGGTAGGCCAGAAAGTGCAAAACACCAGCATAAAAAGGACAAAGAAAAAAAAATTCTG
GGAAAGGACCCCCCTCCTGGGGCGTTTTGAAGAGAAGCTGAGGACATTCAATTCAAACGGAACCGCCCCAAATGAAGGCTTTGGAAATTTGTC
>LE_HBa0008C04_SP6_3174 (trimmed for quality and cloning vector)
CTTCTGCAGCTGTTAATCAGCTCTCTGATATCATCCTTAAGGATGTACCGTTAAGGGCTAATGTGCAAATTTCGTTTGATAACACTATTCCTTGCGGTTC
TCCGGGTGATTTTTCTGTGGCAGCAATAGCTGGAATCTCCGCTATCTTGGATCATCGAAGTTCAGCTTTGTCTGTTATTACTGATGCTATTGCTGCCTTG
TCCTGCGAGGCCTTGGGGGCTGACATTTCAGCTTTCAATTTGAATGATTCCGGTGATGGTTCATCTGCCAAGGACGTTGTTGCCGTGGCTTCTGACTTGA
AGATCTTGCTTAACGGTTCTAAATTTGTTAACCGTGAGGGTGATGAACCTGCAGTTTCTGGTGTTCCCGTGGTGCACGGCAAGTTTAGGGAGATTTCCCG
ACTCCTGCACTCCAGCACCCGTGTCCAATTGAACTCTGCAACTGTATCCAATTCTGGATCTTCTGGTACAGCCAGCTCCATGTGCACCACGCTGTTTTCC
TTGGCTGTGGCCCTCAAGGATTTGGGTAACATCAGTTATAACCGAGCAAAGCGCATTGTCGATTCTCGCATTACTGGAGATGATGAATTTCCTGCAATGC
TGATAAAAGAATGTCCTCGCCCTGATCAGCTAAAAGCTCTTTTCGCATCTTTGGTGTCAGCTCACTCGGATGAGGAATATGTTAAGTTCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.977658
Expected error %
0.54539
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV32201.1| Score 85 E Value 2e-15 Identity 16.50% Align. Length 284bp (41.10%) Frame 1
histidyl-tRNA synthetase [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008C04
Clone
Clone name
hba-8c4
LE_HBa0008C04
P008C04
Clone type
BAC
Contamination
none
Estimated length
99,143
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found