Clone Read LE_HBa0099O23_T7_31821

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0099O23_T7_31821
Primer
T7
ID from Seq. Facility
LE_HBa_099_O23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
136 trimmed for vector and quality, 711 raw
Sequence
>LE_HBa0099O23_T7_31821 (raw untrimmed)
TAAAACTGTCATAATTAATGGATCAATTATACCTATATTGGGCCCTAACAAAATTGANAGTTGATAGCCCGTATCTTAGCAGGGGCTCAACATAGTTTGA
ATTGTGAGACATCGTTTTCACTACAATCATTTTTGAGGTGTATACCAATAGACCGGAATAAATTATATATACTTCATATTTTTTTTGTGCCAATGAGACA
CAATCCTCTTAACTCCAGATCAATATAATAATTACTAAATCTCAAATCTTTGTTCTATATATACTATATTTATACTCACTTTGCCTCCTCAAATTACAAA
TAAATTTATAAAACTATTTCTAAAAATATATGCTTTCTAATTAGACTCACTTACCTCCCATTTAATTGTGGGGGAGAAACGATAACCTTCATTCCCCCCC
CCCCTCCCTGTGACTTCCCGCTGCCTAAAAAATCACGCTTTAGACCCCCCGCCAACCCCGCTCCACTCCTCTCTCCTGCCCACACACTTACTACTCATAC
CTTCACTCTCCACCCTATATTCTCCAGACTTCACAATCTACAAACCAGCACATACCTGCCTTATTACACTTCATCTGTTTCTCTTTTCCTCTATTTGTTT
CTTGACTCATATATCCCATTATATCGATGCATCAACACCCAACAACCGAAAGACGTGCATAGCAAGAAGCACATCCTATCTTCCATCTACTAATCATTAT
TCCATTAATCC
>LE_HBa0099O23_T7_31821 (trimmed for quality and cloning vector)
TTAGCAGGGGCTCAACATAGTTTGAATTGTGAGACATCGTTTTCACTACAATCATTTTTGAGGTGTATACCAATAGACCGGAATAAATTATATATACTTC
ATATTTTTTTTGTGCCAATGAGACACAATCCTCTTA

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.929833
Expected error %
1.17612
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0099O23
Clone
Clone name
hba-99o23
LE_HBa0099O23
C03HBa0099O23
P099O23
Clone type
BAC
Contamination
none
Estimated length
188,231
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found