Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0099P03_SP6_31828

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0099P03_SP6_31828
Primer
SP6
ID from Seq. Facility
LE_HBa_099_P03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
595 trimmed for vector and quality, 874 raw
Sequence
>LE_HBa0099P03_SP6_31828 (raw untrimmed)
AATCATTAAATAATTAAGTCCTTGATTAAACATATATATTTTGTACTTTTTTCTCCCTTCGCGTGTTTTTCATTAAAGCTCACGGCCTCACGCTTTTTTT
GCTCTTAATTCCCTTAGTGATCTCTAGAGCTTTTGAGTTTACTGCTATTGACAACACTCAACACTGGGTGGGTGGTAGTAGCTTCAGTGATTGAAAGATA
AAGAGATATGAGTAAGAGTAGAAATGTATGCCTAGTATAAGATGGGTAAGAACAGAAATATCTGTGCTGTATAAGAAAAAAGAACAAGGATATGGATTAA
ATGGGAGTCAGGTGGCTTGGTAATGTCTGTACTGATTACTAAAACCAATCTACTCCTGCCGATACCCAATCTAATCCACAAATTTGACACTATGCCTGAG
AATTTCATGTAATGTATGAAAGAGTTTGGGTTGTATGCTCAACCATGCAAACATATGAGTGTAATACTTTTCAGAACTTAATGTCAGCCACAGGAAAATA
GAAGATAAATTTGAATTTTTTGACTTGTCACAAAAATACTTTCAAATAATTATATGAAACCATTTGCAAGTGTAGACACATCATATATATGTATCTACAT
GTGTGTGCTAAAAAAATAATTACTTGATGACAGAGACATAGATGGGTAAATGGCTGTTTGGGTTTTTGAGTGATGAATAATTTGGAGACGACAATCGTTC
TAGGATTTATAACTAGTCGCAACACTTAAGTCGTTGGTTTTGTAGATGACGCAAGTTAAGTGGCGGATTATGAAAGATTTATTTGTATTGAATTATATAA
AGTTATGTGCTTGAGTTATTACTCACATTGTTTTCTTTTTATTTAATCATCTATGTTTCTATTTTAACTAAAAT
>LE_HBa0099P03_SP6_31828 (trimmed for quality and cloning vector)
GATTAAACATATATATTTTGTACTTTTTTCTCCCTTCGCGTGTTTTTCATTAAAGCTCACGGCCTCACGCTTTTTTTGCTCTTAATTCCCTTAGTGATCT
CTAGAGCTTTTGAGTTTACTGCTATTGACAACACTCAACACTGGGTGGGTGGTAGTAGCTTCAGTGATTGAAAGATAAAGAGATATGAGTAAGAGTAGAA
ATGTATGCCTAGTATAAGATGGGTAAGAACAGAAATATCTGTGCTGTATAAGAAAAAAGAACAAGGATATGGATTAAATGGGAGTCAGGTGGCTTGGTAA
TGTCTGTACTGATTACTAAAACCAATCTACTCCTGCCGATACCCAATCTAATCCACAAATTTGACACTATGCCTGAGAATTTCATGTAATGTATGAAAGA
GTTTGGGTTGTATGCTCAACCATGCAAACATATGAGTGTAATACTTTTCAGAACTTAATGTCAGCCACAGGAAAATAGAAGATAAATTTGAATTTTTTGA
CTTGTCACAAAAATACTTTCAAATAATTATATGAAACCATTTGCAAGTGTAGACACATCATATATATGTATCTACATGTGTGTGCTAAAAAAATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952739
Expected error %
0.312078
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0099P03
Clone
Clone name
hba-99p3
LE_HBa0099P03
C09HBa0099P03
P099P03
Clone type
BAC
Contamination
none
Estimated length
144,667
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found