Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0099P03_T7_31829

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0099P03_T7_31829
Primer
T7
ID from Seq. Facility
LE_HBa_099_P03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
700 trimmed for vector and quality, 859 raw
Sequence
>LE_HBa0099P03_T7_31829 (raw untrimmed)
CAAACCCGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACATATTTTGTTTTCAGCAAACTTCATTTTGGGCAACCCTCGGACT
GGGTCCTTTGAAATCAATTTATTCAATAAAGATGAACTCACATGTCCCAGCCTACGATGCCAGAGATCAGCATTTTCATTTTGAGCACTGAGACATGTTA
AGTCATCTCCATGAGAGATTTCCAAGTTTGCCACATACATATTTTTACTTCTGTGTGCAGTGAGAATTACCTTGTTTGTAGTTAAACTCACCACAGTGCA
TTTTTCAGAAGTAAACTTGACCTCATTTCCTTTATCACAGATTTGTGACACACTTAGCAAGCTGTACTTTAACCCATCCACATGGTAAACATTGTCAATT
GAATCTTCAAGAGATCTTCCTACTTTGCCAACTCCCAAAATGTACCCCTTCTTGCCATCACCAAATGAGACACCTCCTCCTTGGAGGGTCTTGAGTGAGA
GGAAGTTCTTTACATCACCAGTCATATGTTTAGAGCAGCCACTATCCATATACCAACATTGTCTGCTGCTCCTCTCACTCACCTGCATCAAAAATCACTT
GTTAAGCTTGGGAACTCATTTCAGCTTGAGTTCCCAGTAGGCAAAATAAAGGAGTGATCAGATTGTACTTGGTCCAATATGGTAGACTTTGAATCTTTCT
AACCGAAGGACCTAGGAGCAGGAACAGATTTTTTCTTTGAAAATCTGTGAGTTGAAACAGGATCTGTACGACCCGGCCCCTCTCCTGGTACCTCTTTCTT
TCTCAGCTTCTGCAGAGCTTCTCCTTAATGAATTTTCCGCCTATCTCACGTCTTTTCTG
>LE_HBa0099P03_T7_31829 (trimmed for quality and cloning vector)
AGCTTCACATATTTTGTTTTCAGCAAACTTCATTTTGGGCAACCCTCGGACTGGGTCCTTTGAAATCAATTTATTCAATAAAGATGAACTCACATGTCCC
AGCCTACGATGCCAGAGATCAGCATTTTCATTTTGAGCACTGAGACATGTTAAGTCATCTCCATGAGAGATTTCCAAGTTTGCCACATACATATTTTTAC
TTCTGTGTGCAGTGAGAATTACCTTGTTTGTAGTTAAACTCACCACAGTGCATTTTTCAGAAGTAAACTTGACCTCATTTCCTTTATCACAGATTTGTGA
CACACTTAGCAAGCTGTACTTTAACCCATCCACATGGTAAACATTGTCAATTGAATCTTCAAGAGATCTTCCTACTTTGCCAACTCCCAAAATGTACCCC
TTCTTGCCATCACCAAATGAGACACCTCCTCCTTGGAGGGTCTTGAGTGAGAGGAAGTTCTTTACATCACCAGTCATATGTTTAGAGCAGCCACTATCCA
TATACCAACATTGTCTGCTGCTCCTCTCACTCACCTGCATCAAAAATCACTTGTTAAGCTTGGGAACTCATTTCAGCTTGAGTTCCCAGTAGGCAAAATA
AAGGAGTGATCAGATTGTACTTGGTCCAATATGGTAGACTTTGAATCTTTCTAACCGAAGGACCTAGGAGCAGGAACAGATTTTTTCTTTGAAAATCTGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962712
Expected error %
0.660835
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO73527.1| Score 115 E Value 1e-24 Identity 12.20% Align. Length 515bp (73.57%) Frame 2
gag-pol polyprotein [Glycine max]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO73521.1| Score 115 E Value 1e-24 Identity 12.20% Align. Length 515bp (73.57%) Frame 2
gag-pol polyprotein [Glycine max]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0099P03
Clone
Clone name
hba-99p3
LE_HBa0099P03
C09HBa0099P03
P099P03
Clone type
BAC
Contamination
none
Estimated length
144,667
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found