Clone Read LE_HBa0100I03_SP6_32260

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0100I03_SP6_32260
Primer
SP6
ID from Seq. Facility
LE_HBa_100_I03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
824 trimmed for vector and quality, 908 raw
Genbank Accession
Sequence
>LE_HBa0100I03_SP6_32260 (raw untrimmed)
AAACACTTGAACGANCGTTATGGTATATTAATCCTAATATTGATGAAAATTCAGGTGAAGAAGTAGAAGCTGATTTGGTAGAAGAGGAGTTAAAAGAAAC
ACCTACGAGTCCGGTGACAGAAGTTCCAAATGAAACTATTAATTTATCGGAGCAAATTTTTGGACATCCACCCCTTATACCTCCCACAAGGGAAAAGCTG
AAGTATCAACGACCTAAAACTTCTATTGTGTGGCAATTCATGACTTTTGATAAAGAAAATAGTGTTGCTATTTGTAATAAGTGTAAGCAACCCTTTAAAC
ATAAACAAGATGGGGGTCAAGGTGGAACGGAGGGATTAAATAGACATTTGTTATCTTGTGTGTCGATTCAATATAAAGAAGCTAAAGCATTAACCAATAG
AAAAAAGGGAATTTCAATTAATGAATTAGATATTACCAGTAATGCATTGATAGGGGCTTCTAACGTGGTTCAAGGAACATTAGATCCTTTTAACCCCGCT
GGTCCAATAACACAACGTAAATATAATAAGGAATTAGATTGGAAAAATTTAGCTAAAATGGTTTCCGTTTGTAGTTTGCCTTATAGTTTTCCTTCAAATC
CCAATTTTATTGAATATATTCAACAAACTTATAATTCAGATTATAGAGGTTTTTCAAGAAATACTATTAAATCTGATGTTTTTGAATATCAAGGTAAACA
TTGTCAATATCTTCGTTGTCTATTTAGCATATTAGATAGTAGAGTGTCTACAACTTCGGACATGGGTCATAGTGTTAATGGAAATGATTATTTAACTATT
ATTGCACATTGGATTGATCATGATTGGAATTTGCTAAAAACAATTATAAGTTATAAACTATGTTTAGATAAAAAAACTTGTGCATATTTACCTTCATCTA
TTTTAAGG
>LE_HBa0100I03_SP6_32260 (trimmed for quality and cloning vector)
TTATGGTATATTAATCCTAATATTGATGAAAATTCAGGTGAAGAAGTAGAAGCTGATTTGGTAGAAGAGGAGTTAAAAGAAACACCTACGAGTCCGGTGA
CAGAAGTTCCAAATGAAACTATTAATTTATCGGAGCAAATTTTTGGACATCCACCCCTTATACCTCCCACAAGGGAAAAGCTGAAGTATCAACGACCTAA
AACTTCTATTGTGTGGCAATTCATGACTTTTGATAAAGAAAATAGTGTTGCTATTTGTAATAAGTGTAAGCAACCCTTTAAACATAAACAAGATGGGGGT
CAAGGTGGAACGGAGGGATTAAATAGACATTTGTTATCTTGTGTGTCGATTCAATATAAAGAAGCTAAAGCATTAACCAATAGAAAAAAGGGAATTTCAA
TTAATGAATTAGATATTACCAGTAATGCATTGATAGGGGCTTCTAACGTGGTTCAAGGAACATTAGATCCTTTTAACCCCGCTGGTCCAATAACACAACG
TAAATATAATAAGGAATTAGATTGGAAAAATTTAGCTAAAATGGTTTCCGTTTGTAGTTTGCCTTATAGTTTTCCTTCAAATCCCAATTTTATTGAATAT
ATTCAACAAACTTATAATTCAGATTATAGAGGTTTTTCAAGAAATACTATTAAATCTGATGTTTTTGAATATCAAGGTAAACATTGTCAATATCTTCGTT
GTCTATTTAGCATATTAGATAGTAGAGTGTCTACAACTTCGGACATGGGTCATAGTGTTAATGGAAATGATTATTTAACTATTATTGCACATTGGATTGA
TCATGATTGGAATTTGCTAAAAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.942531
Expected error %
0.126366
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_475833.1| Score 95 E Value 3e-18 Identity 10.10% Align. Length 734bp (89.08%) Frame 2
putative transposase [Oryza sativa (japonica cultivar-group)] gb|AAT44190.1| putative transposase [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39288.1| Score 93 E Value 8e-18 Identity 13.60% Align. Length 374bp (45.39%) Frame 2
putative transposase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0100I03
Clone
Clone name
hba-100i3
LE_HBa0100I03
P100I03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found