Clone Read LE_HBa0100I18_SP6_32290

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0100I18_SP6_32290
Primer
SP6
ID from Seq. Facility
LE_HBa_100_I18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
770 trimmed for vector and quality, 941 raw
Genbank Accession
Sequence
>LE_HBa0100I18_SP6_32290 (raw untrimmed)
GCGGCCTTGGCGGTTGCTTTTGGGGGTCTGAATTCTGTCCCTGGTAGTACCATTCAGGTGATTAAGAATCTAAGGATATGTGGAGACTGTCATACAACAA
TTAAGCTAATATCCAAGATTGTTAGTAGGGAAATTGTAGTCAGAGATGCAAAGAGATTTCACCATTTCAAGGACGGCTCATGCTCATGTGGGGACTATTG
GTGATTGAGTAATAGAGATTTGCATGGTGGTGCATAGCATAATTTGATAGAGATTTGCATGGAATATGATTTTCTTCAATCTCAAACTAGTTGTGTGGTA
TGTCATGTGTCAAAGCAAAAGAGAGAAAGCGGAGAAGTAAGTAGAATATGCAACTTTTCTTCTCTTCAATGAAAATCTTGTTTCTTTGGTTGAGACAAGT
AGGAATTTTGGACTTAGGAGTATGTTAATTTTTTGATAAAAAGTAATATACTTTATTAAAATAATAGTATAATAACCATCCAAATAGATGAAATGCCAAT
CATTTTGGTACTATTGAATAGAATTCTAACGTATATTCAGAAGAACCAAGTTGTTGTGGGTAAATAAATTGTTGGATGATTGCTTTTATCGATATTCGAT
ACAACACCCCTAAAGCATATACGGTTAAGGTCCTGCCAACTTGCATTTACCGTTATGCCCGTACTTGTCTGCTTTCTTTTTATGCTCTTCTTCTCCTTTT
ACCTTATTTTTATCTCAATAATCGAATCATAACATATCGATTCATAAAACTTATTCAACATATAGAGCACTCCTTTAATTGTTTGCAATGTCACTGCCAA
AGACTATCTTCAGAGTATTTATCTTTGTTTAATACGACTCTATAAATTAAATCAAATAAAACTTCTCAATTATATAATATAATTATGCAATTTTCAATCA
TATATAAAACTATATTAAAAAAATAACATGATAATCCTTCT
>LE_HBa0100I18_SP6_32290 (trimmed for quality and cloning vector)
TGAATTCTGTCCCTGGTAGTACCATTCAGGTGATTAAGAATCTAAGGATATGTGGAGACTGTCATACAACAATTAAGCTAATATCCAAGATTGTTAGTAG
GGAAATTGTAGTCAGAGATGCAAAGAGATTTCACCATTTCAAGGACGGCTCATGCTCATGTGGGGACTATTGGTGATTGAGTAATAGAGATTTGCATGGT
GGTGCATAGCATAATTTGATAGAGATTTGCATGGAATATGATTTTCTTCAATCTCAAACTAGTTGTGTGGTATGTCATGTGTCAAAGCAAAAGAGAGAAA
GCGGAGAAGTAAGTAGAATATGCAACTTTTCTTCTCTTCAATGAAAATCTTGTTTCTTTGGTTGAGACAAGTAGGAATTTTGGACTTAGGAGTATGTTAA
TTTTTTGATAAAAAGTAATATACTTTATTAAAATAATAGTATAATAACCATCCAAATAGATGAAATGCCAATCATTTTGGTACTATTGAATAGAATTCTA
ACGTATATTCAGAAGAACCAAGTTGTTGTGGGTAAATAAATTGTTGGATGATTGCTTTTATCGATATTCGATACAACACCCCTAAAGCATATACGGTTAA
GGTCCTGCCAACTTGCATTTACCGTTATGCCCGTACTTGTCTGCTTTCTTTTTATGCTCTTCTTCTCCTTTTACCTTATTTTTATCTCAATAATCGAATC
ATAACATATCGATTCATAAAACTTATTCAACATATAGAGCACTCCTTTAATTGTTTGCAATGTCACTGCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.948805
Expected error %
0.168628
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g26780.1 Score 109 E Value 2e-24 Identity 26.90% Align. Length 170bp (22.08%) Frame 1
68416.m03350 phosphoglycerate/bisphosphoglycerate mutase family protein similar to X4 protein GI:21386798, Y4 protein GI:21386800 from [Silene dioica]; contains Pfam profiles PF00300: phosphoglycerate mutase family, PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g24000.1 Score 100 E Value 7e-22 Identity 24.00% Align. Length 170bp (22.08%) Frame 1
68416.m03014 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_189313.1| Score 109 E Value 9e-23 Identity 26.90% Align. Length 170bp (22.08%) Frame 1
phosphoglycerate/bisphosphoglycerate mutase family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB01225.1| Score 109 E Value 9e-23 Identity 26.90% Align. Length 170bp (22.08%) Frame 1
selenium-binding protein-like [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0100I18
Clone
Clone name
hba-100i18
LE_HBa0100I18
C02HBa0100I18
P100I18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found