Clone Read LE_HBa0100L22_T7_32443

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0100L22_T7_32443
Primer
T7
ID from Seq. Facility
LE_HBa_100_L22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
804 trimmed for vector and quality, 886 raw
Genbank Accession
Sequence
>LE_HBa0100L22_T7_32443 (raw untrimmed)
ATAAAACACTGGACCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCACACACCTCACACACCTCGACTATTCCACTCAGTATCTTCTACC
TCTCACCAAGACAAGTATCGGATAACTCTGCTGGCTAAGGCTTAAATAAATGGGGGAAAAAATCACGTAAGGTATCTTCTAGCTCTCCCATTTTATTGTC
CGCTAGACCACACCCTTGGATGCTAGAGAATTTTCTATATCAAACTCGTTTTTTTATGCAATGATAGTATTCATAGCCATACCTCTCAAAGAAAAATGGT
TGTCACCAATAAATTAACAAGTCTTTCGTTGCTCGATTCCACATACAAATACAAGTCAAATTCACAAAAGCATATAATTGAACTTTGAGTAAATGGCTCC
AGATGTAAAAATGGAAAACCTCAAGTGATTCAAAGTCATTAGGCCCAAGTGGATCTGAGAAACTTTCTGAGATACATCTAGTAACCAATAGTCCTGAATA
CCGAAAAAGATCACATTCATGAGCAAGAAAAAAGACATTATCAACTAAAACTTTGAGCAAAGTATTACAATTGAGTTTAGAAATCACTTACTTGGCAATG
TGGATTGTATAGCTGATGGAAACCCCACCAATCGTACCCCTTCAAGAACCCAAATACAAATTGGACTAATTCATTAAAAGGGATAGTAGAAACACACTTG
ATACTGAAAAATAAAACAATCACAAAATCTGATAACTTTTCTGAGATACATCTACTAAACAACCGCTTGAATTACACCTATATAAAAAGATCACATTCAT
GAACCTAAATAAAGTACATTAATCACTAAACTTGAGAAGCAAAAGGATCTCAACTTTGAGTAAAAAGAACATATTAAATTTTCAAG
>LE_HBa0100L22_T7_32443 (trimmed for quality and cloning vector)
AGCTTGCACACACCTCACACACCTCGACTATTCCACTCAGTATCTTCTACCTCTCACCAAGACAAGTATCGGATAACTCTGCTGGCTAAGGCTTAAATAA
ATGGGGGAAAAAATCACGTAAGGTATCTTCTAGCTCTCCCATTTTATTGTCCGCTAGACCACACCCTTGGATGCTAGAGAATTTTCTATATCAAACTCGT
TTTTTTATGCAATGATAGTATTCATAGCCATACCTCTCAAAGAAAAATGGTTGTCACCAATAAATTAACAAGTCTTTCGTTGCTCGATTCCACATACAAA
TACAAGTCAAATTCACAAAAGCATATAATTGAACTTTGAGTAAATGGCTCCAGATGTAAAAATGGAAAACCTCAAGTGATTCAAAGTCATTAGGCCCAAG
TGGATCTGAGAAACTTTCTGAGATACATCTAGTAACCAATAGTCCTGAATACCGAAAAAGATCACATTCATGAGCAAGAAAAAAGACATTATCAACTAAA
ACTTTGAGCAAAGTATTACAATTGAGTTTAGAAATCACTTACTTGGCAATGTGGATTGTATAGCTGATGGAAACCCCACCAATCGTACCCCTTCAAGAAC
CCAAATACAAATTGGACTAATTCATTAAAAGGGATAGTAGAAACACACTTGATACTGAAAAATAAAACAATCACAAAATCTGATAACTTTTCTGAGATAC
ATCTACTAAACAACCGCTTGAATTACACCTATATAAAAAGATCACATTCATGAACCTAAATAAAGTACATTAATCACTAAACTTGAGAAGCAAAAGGATC
TCAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947923
Expected error %
0.401772
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0100L22
Clone
Clone name
hba-100l22
LE_HBa0100L22
P100L22
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found