Clone Read LE_HBa0103N19_SP6_33300

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0103N19_SP6_33300
Primer
SP6
ID from Seq. Facility
LE_HBa_103_N19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
717 trimmed for vector and quality, 790 raw
Sequence
>LE_HBa0103N19_SP6_33300 (raw untrimmed)
GTTTGAATTTGGGATTGCCCTGCGAAAGTGAGGACCTACCCAACTTNGGATGAGTAACAATTACAAGTCTTCCCTCAAAGTTTTCTCAAAATTCCCTTTA
ATGACCGGAACCTAACATAATGGGGAAAAGGAAGAAAGTTGGATTAGCACATCACATTTACTAAGTATTAAACCATATGAACATATTATATCAGACCATG
CTAAAAAAGGACATTTCATAAAGACATGCTACCTTTCATTTGGAAAGTCTTATGCACATTCAAGAACTAATACAAGTCGTTAATTCATATTGATCAAGTC
AATACCATGTACTATTCAAGACAAAACCACCTTAAGTCAAATCAAGTCACATGCATATCAGCATATACTTGAACACATAATTGAATATGACTCTATGATC
AAGTCATAACATCACAAGCATGAATAAGAGTTCATCACATTATAACCAAGCAAGATTATTACACATGACGCAAAGACCCATAATCGTACTTAATCAAGTA
AACCTAGAAAGAACATAACCAATGTCCAACTCAACATAATTTATCATTAGGAGTACATAATATCATACTTTAGCAATAAATACTAGATATATGTTCATAA
GAGTAACCTACGTCGCATAGTGTCATTTACATGTAATATCATCACATTATCATCATTTACATTTTTAAGCATATACATACATAAGAAAAATCTCCTTAGG
TTTCGCTCGTGGAAAACTAGTGCAATGCATAGGTAAAGTCACATACCCCTACCTAGGCTAAGTCAAACCTCTTAAGTCACCCTAGTAAAT
>LE_HBa0103N19_SP6_33300 (trimmed for quality and cloning vector)
ATTGCCCTGCGAAAGTGAGGACCTACCCAACTTNGGATGAGTAACAATTACAAGTCTTCCCTCAAAGTTTTCTCAAAATTCCCTTTAATGACCGGAACCT
AACATAATGGGGAAAAGGAAGAAAGTTGGATTAGCACATCACATTTACTAAGTATTAAACCATATGAACATATTATATCAGACCATGCTAAAAAAGGACA
TTTCATAAAGACATGCTACCTTTCATTTGGAAAGTCTTATGCACATTCAAGAACTAATACAAGTCGTTAATTCATATTGATCAAGTCAATACCATGTACT
ATTCAAGACAAAACCACCTTAAGTCAAATCAAGTCACATGCATATCAGCATATACTTGAACACATAATTGAATATGACTCTATGATCAAGTCATAACATC
ACAAGCATGAATAAGAGTTCATCACATTATAACCAAGCAAGATTATTACACATGACGCAAAGACCCATAATCGTACTTAATCAAGTAAACCTAGAAAGAA
CATAACCAATGTCCAACTCAACATAATTTATCATTAGGAGTACATAATATCATACTTTAGCAATAAATACTAGATATATGTTCATAAGAGTAACCTACGT
CGCATAGTGTCATTTACATGTAATATCATCACATTATCATCATTTACATTTTTAAGCATATACATACATAAGAAAAATCTCCTTAGGTTTCGCTCGTGGA
AAACTAGTGCAATGCAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940295
Expected error %
0.404012
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0103N19
Clone
Clone name
hba-103n19
LE_HBa0103N19
P103N19
Clone type
BAC
Contamination
none
Estimated length
96,869
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found