Clone Read LE_HBa0104B02_T7_33459

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0104B02_T7_33459
Primer
T7
ID from Seq. Facility
LE_HBa_104_B02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
209 trimmed for vector and quality, 771 raw
Genbank Accession
Sequence
>LE_HBa0104B02_T7_33459 (raw untrimmed)
AAAATTACTGAATCTCTCAGATCTGAAGATTCACGAACTGAACATCACGAACGGGACGGATTGTTAGGCTTCTCGAGGAGGCAAGATACTTCCTTTACTC
GACAAGAAT
TAAGGGAAGACTAGTTTGATGATGAGAAACTAAGAAGAATCCAAGATAAAGTATTGCGAGGGGAGGCTAAGGAAGCACAAATCGATGAGGA
AGGTGTTTTGAGAATCAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTCAAGGTATTCTATACAT
CCGGGTGCAACCGAGATGTATCGTAACCTAATACAACACTTTTGGTGGAGTAGAATCACCCGTTACATTGTGGATTCTATTGCTATATGTCCTTATTGTC
AATAAGTTAAGTATTGACATTTTAGGCCCGGACGAACTCCTCAAAAATTAGCCATTGGGCATTGCGAAAGATGACAATCAGTCTTGAATCTTGTTCTCAC
TCTTCTCTTAAATCCACATTTGCCTTATATTCTTGTTTCCTTCTTTCATACCGTCACGCAGCTGTGGTTCGTGGCCTGTTTGGCGACGACACCATACTCC
TCGTTAGATACGTCCTTAGTGACCATGTCGTTACGTGCGCGATTTGCGACGAGGCAGAGTCTTGTTTAATAAATGCGTGTCGCCTTCGTCTCCAGATCAT
CTATGCACGTTATGTATGCAAGACGAACATACATAGCTNTCAACTACACCGTTGTTCCTCTCTGTTCTCTG
>LE_HBa0104B02_T7_33459 (trimmed for quality and cloning vector)
TAAGGGAAGACTAGTTTGATGATGAGAAACTAAGAAGAATCCAAGATAAAGTATTGCGAGGGGAGGCTAAGGAAGCACAAATCGATGAGGAAGGTGTTTT
GAGAATCAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTCAAGGTATTCTATACATCCGGGTGCA
ACCGAGATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957923
Expected error %
0.501047
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 81 E Value 8e-15 Identity 19.00% Align. Length 194bp (92.82%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 79 E Value 4e-14 Identity 17.90% Align. Length 194bp (92.82%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0104B02
Clone
Clone name
hba-104b2
LE_HBa0104B02
P104B02
Clone type
BAC
Contamination
none
Estimated length
121,463
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found