Clone Read LE_HBa0104D02_SP6_33554

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0104D02_SP6_33554
Primer
SP6
ID from Seq. Facility
LE_HBa_104_D02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
694 trimmed for vector and quality, 856 raw
Genbank Accession
Sequence
>LE_HBa0104D02_SP6_33554 (raw untrimmed)
GGGGGGGGCAGTTTTTTTTTTACTACTTTGCGACTTCTTTAGATTGTTGGATGAAGAATTACTTCGGTAGATTGTTGTTTCTCTTTCAAAAGTAACACGA
AATCCACATTCAAAATTTTAGTTCCTTAGGTAATACCAATATAGTACTTCTTTGTATTCCATGACTCAATTAGATCTAATGCCGAACTATTATTTAAGCT
TGATGAGCTAAATACTTAACAGGTGACAAGAATAAAGAAACAGTCATGAAAAAGAAAGAGCACAGATGCAAAAGGAAAGTCAGAATTACCTCTCCGTTTG
ACCTCAACAGTTGGTTCAGCAGTGGCACGTCTCATCAGTTCTAGAGCACCCTTGAAATTCCTGTGACGTAGTTCCATCTCGGCCCATTCACACCAAACAC
TAGCCAGATGATCAACAGTTTTATAATTCACCTGCACTGCCTTATCAAAGATGACTCTTGCATTTGCAATATCCTTATGGTTTTCATAAAGTTTTGCAAA
TGCAACCCACAAAGTATGTGGCTTCCCCACAGCTTTCATTGGGTCAATAGTTCTAACTGCCTCAGTGAACGTTAATATTTGCTTTGTTGGATTCCCTTCG
AATAGTTTTACCCTTCTATGCCACTGCTCTACATTATGCGGATTTTGCCTCAAAAGCACACTATTCGCAAGCTCTGGCCTCCTATCCATAAGATGTTCTA
ACCTCGCTAATCTCAAGTCAATATCCTTATCATCATTTAGCCAAAACTCTTTAAGCTTCTTCCCAATTTTGCCACATTCAACCTATCATCCTCCTCATCC
ACATCCTTCCTCTGCCCCAACCTCACCGTTAGTCCCTTCATCCTCCCCCACACCAT
>LE_HBa0104D02_SP6_33554 (trimmed for quality and cloning vector)
CGACTTCTTTAGATTGTTGGATGAAGAATTACTTCGGTAGATTGTTGTTTCTCTTTCAAAAGTAACACGAAATCCACATTCAAAATTTTAGTTCCTTAGG
TAATACCAATATAGTACTTCTTTGTATTCCATGACTCAATTAGATCTAATGCCGAACTATTATTTAAGCTTGATGAGCTAAATACTTAACAGGTGACAAG
AATAAAGAAACAGTCATGAAAAAGAAAGAGCACAGATGCAAAAGGAAAGTCAGAATTACCTCTCCGTTTGACCTCAACAGTTGGTTCAGCAGTGGCACGT
CTCATCAGTTCTAGAGCACCCTTGAAATTCCTGTGACGTAGTTCCATCTCGGCCCATTCACACCAAACACTAGCCAGATGATCAACAGTTTTATAATTCA
CCTGCACTGCCTTATCAAAGATGACTCTTGCATTTGCAATATCCTTATGGTTTTCATAAAGTTTTGCAAATGCAACCCACAAAGTATGTGGCTTCCCCAC
AGCTTTCATTGGGTCAATAGTTCTAACTGCCTCAGTGAACGTTAATATTTGCTTTGTTGGATTCCCTTCGAATAGTTTTACCCTTCTATGCCACTGCTCT
ACATTATGCGGATTTTGCCTCAAAAGCACACTATTCGCAAGCTCTGGCCTCCTATCCATAAGATGTTCTAACCTCGCTAATCTCAAGTCAATAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.966898
Expected error %
0.346471
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g28740.1 Score 273 E Value 7e-74 Identity 29.30% Align. Length 443bp (63.83%) Frame 1
68418.m03530 transcription-coupled DNA repair protein-related similar to XAB2 (XPA-binding protein 2) [Homo sapiens] GI:10566459
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_198226.1| Score 273 E Value 3e-72 Identity 29.30% Align. Length 443bp (63.83%) Frame 1
transcription-coupled DNA repair protein-related [Arabidopsis thaliana] gb|AAF67364.1| Hypothetical protein T32B20.g [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_479318.1| Score 234 E Value 2e-60 Identity 24.50% Align. Length 440bp (63.40%) Frame 1
putative adapter protein ATH-55 [Oryza sativa (japonica cultivar-group)] ref|XP_506511.1| PREDICTED OJ1458_B07.103 gene product [Oryza sativa (japonica cultivar-group)] dbj|BAD30261.1| putative adapter protein ATH-55 [Oryza sativa (japonica cultivar-group)] dbj|BAC07006.1| putative adapter protein ATH-55 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0104D02
Clone
Clone name
hba-104d2
LE_HBa0104D02
P104D02
Clone type
BAC
Contamination
none
Estimated length
116,698
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found