Clone Read LE_HBa0104J17_SP6_33872

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0104J17_SP6_33872
Primer
SP6
ID from Seq. Facility
LE_HBa_104_J17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
666 trimmed for vector and quality, 906 raw
Genbank Accession
Sequence
>LE_HBa0104J17_SP6_33872 (raw untrimmed)
GGGCAAGATAACCTAAACCCCTTTCTGTTAATGATGATGTCTTGGTATAAAAGAAGGTTTGATGAACTAAAAGAACGTTTTTAATGGATCGGGTGTCACG
TTCCGACACCACGATAGCTTTAGTGGATCGGGTGTCACGTTCCGACTTGCTTCATGGATGGCTATTATTTCTGCATGATTTGAAGAAGTGGCTACCAATG
TTTGCTTCATTGATCGCCAAGATATTGCCGTGTCTCCACATGTAAACAAATAGCATGTTTGTGATCGAGTTTTATGCGGATCTGATAAATACCCTGCATC
TGCGTAACCAATCAGTTCTGATTTGGATTCATTGGAATAGAATAAACCCATGTCCATGGTCCCTCTAAGATATCGAAGTATGTGTTTAACACCATTCCAA
TGTCTTTTTGTTGGGGAGGAACTGAATCTTGCCAGTAGACTTACTGCAAAACAGATATCTGGTCGAGTATTGTTAGCAAGGTACATTAGTGCCCCGATCG
CACTAAGATAAGGAGTTTCATCACCAAGAAGCTCTTCATCATTCTCTTGAGGTCGAAATGGATCTGTATTGATGTCAAGAGATCTTACCATCATTGGAGT
ACTCAATGGATGTGAGTTATCCATGTAAAAACGCTTTAGTATCTTTTCTGTGTACGTTGATTGATGAACAAGTATTCCATTTGACAAATTCTCAATCTGT
AAACCAAGACAAAATTTTGTCTTGCCGAGATCTTTCATTTCAAATTTCCTTTTCAGACACTCCACAGCTTCTAAAAGCACTTTACGAGTTTCAATGACGT
CCAAATCTCCCCCTACTCAGCTATTTATTACTAATCTAGACCCCCACCTTTTAATGAAAATGCAGGACAAATCGGTCATTTTTGAACCTTTTTTTAACAA
AATTCA
>LE_HBa0104J17_SP6_33872 (trimmed for quality and cloning vector)
ATGATGATGTCTTGGTATAAAAGAAGGTTTGATGAACTAAAAGAACGTTTTTAATGGATCGGGTGTCACGTTCCGACACCACGATAGCTTTAGTGGATCG
GGTGTCACGTTCCGACTTGCTTCATGGATGGCTATTATTTCTGCATGATTTGAAGAAGTGGCTACCAATGTTTGCTTCATTGATCGCCAAGATATTGCCG
TGTCTCCACATGTAAACAAATAGCATGTTTGTGATCGAGTTTTATGCGGATCTGATAAATACCCTGCATCTGCGTAACCAATCAGTTCTGATTTGGATTC
ATTGGAATAGAATAAACCCATGTCCATGGTCCCTCTAAGATATCGAAGTATGTGTTTAACACCATTCCAATGTCTTTTTGTTGGGGAGGAACTGAATCTT
GCCAGTAGACTTACTGCAAAACAGATATCTGGTCGAGTATTGTTAGCAAGGTACATTAGTGCCCCGATCGCACTAAGATAAGGAGTTTCATCACCAAGAA
GCTCTTCATCATTCTCTTGAGGTCGAAATGGATCTGTATTGATGTCAAGAGATCTTACCATCATTGGAGTACTCAATGGATGTGAGTTATCCATGTAAAA
ACGCTTTAGTATCTTTTCTGTGTACGTTGATTGATGAACAAGTATTCCATTTGACAAATTCTCAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960481
Expected error %
0.421179
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 89 E Value 2e-18 Identity 13.80% Align. Length 377bp (56.61%) Frame 2
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAS79613.1| Score 278 E Value 9e-74 Identity 22.90% Align. Length 554bp (83.18%) Frame 2
putative copia-like polyprotein [Ipomoea trifida]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP53060.1| Score 266 E Value 3e-70 Identity 21.50% Align. Length 614bp (92.19%) Frame 2
putative retroelement [Oryza sativa (japonica cultivar-group)] ref|NP_920773.1| putative retroelement [Oryza sativa (japonica cultivar-group)] gb|AAM74357.1| Putative retroelement [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0104J17
Clone
Clone name
hba-104j17
LE_HBa0104J17
P104J17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found