Clone Read LE_HBa0008G21_SP6_3400

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008G21_SP6_3400
Primer
SP6
ID from Seq. Facility
LE_HBa_008_G21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
829 trimmed for vector and quality, 1032 raw
Genbank Accession
Sequence
>LE_HBa0008G21_SP6_3400 (raw untrimmed)
AATAAAAAAATGTTTTTCATTTTCTACTTCACTGACCTCGGTTCTTAAGAACTAAGCATGTACCAGGTGTTACAGAAGAACATACCAATGCATTCTAGTG
AGAATCTAATATGTTGCACCAACACTGAAGAAGATAGTCTGGTTTATATCTAAGGGAAATAACCTGCACTAAACCAGGTTTTGGTGTCTGGCAAAGGGGA
AAACAATATCAAAGCATCATTTGGTACCAGACCAATATGCTCAGGTATAAAAAAAGATACTTCTAATGGGTAATCAAAGAAAGAAATGCTAGCCCAAGTT
ACTACCAATACAACATAGATGAGTTCATACTGCACATAGAGGTCCTCATTTTTCTGTGAGATTCAAAATGTTAACAATACTTTTGGGGTTGTGGTGCTGA
TAGACTGGAATCGCAACTGCAGAATACCATCTTTTACCCAAAAAAAGTTAAAGAAAGACAATACATCCTCCACCAGCTTAAATGAATTAAAATCATATCA
ATAAAGCAGAAATTTGGTGGTGGAGGAACTATTGGCCTTTCTGTACTTCAGTTACTCCAGTTCTTGAAACAGGCAAAGCAATCTTATGTATAAGGCTGAG
ATGTGCTGCCTCTCAAGGTTTTAAAAGTACCCTTATATATTAAATAGTTTTATAAGTTCCTCGATACAAAATAAATGTTAAGGGGATAACAACTATATCT
TTCATAATAGGGCTTGTTTTACAATTAGGGAAAAGGCATAAATGCCCCCGCCCCCCAAACCATGATCGGAAATCCACAGATACACTTTTTCTTTGCAGGT
CCTATTACCACCTGAACTATTTTAAAATGGAATAATACCCCCCCCCACCGCGATGTTGATGTGGCATAGACAACCAAATGAGTATCCCACTTGTTTATTG
CATGCACTTCATATACATTTTAGCATTAATTTTTTTTCTTCTTGTTTTTTCATTAAACACATTTCTCTTTCCTAATTTTTGATCTTTTTTCTATTCCCTA
TTTCTAAATCTTTATTCTTTCACCGCAATTTC
>LE_HBa0008G21_SP6_3400 (trimmed for quality and cloning vector)
CTCGGTTCTTAAGAACTAAGCATGTACCAGGTGTTACAGAAGAACATACCAATGCATTCTAGTGAGAATCTAATATGTTGCACCAACACTGAAGAAGATA
GTCTGGTTTATATCTAAGGGAAATAACCTGCACTAAACCAGGTTTTGGTGTCTGGCAAAGGGGAAAACAATATCAAAGCATCATTTGGTACCAGACCAAT
ATGCTCAGGTATAAAAAAAGATACTTCTAATGGGTAATCAAAGAAAGAAATGCTAGCCCAAGTTACTACCAATACAACATAGATGAGTTCATACTGCACA
TAGAGGTCCTCATTTTTCTGTGAGATTCAAAATGTTAACAATACTTTTGGGGTTGTGGTGCTGATAGACTGGAATCGCAACTGCAGAATACCATCTTTTA
CCCAAAAAAAGTTAAAGAAAGACAATACATCCTCCACCAGCTTAAATGAATTAAAATCATATCAATAAAGCAGAAATTTGGTGGTGGAGGAACTATTGGC
CTTTCTGTACTTCAGTTACTCCAGTTCTTGAAACAGGCAAAGCAATCTTATGTATAAGGCTGAGATGTGCTGCCTCTCAAGGTTTTAAAAGTACCCTTAT
ATATTAAATAGTTTTATAAGTTCCTCGATACAAAATAAATGTTAAGGGGATAACAACTATATCTTTCATAATAGGGCTTGTTTTACAATTAGGGAAAAGG
CATAAATGCCCCCGCCCCCCAAACCATGATCGGAAATCCACAGATACACTTTTTCTTTGCAGGTCCTATTACCACCTGAACTATTTTAAAATGGAATAAT
ACCCCCCCCCACCGCGATGTTGATGTGGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960759
Expected error %
0.162022
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008G21
Clone
Clone name
hba-8g21
LE_HBa0008G21
C12HBa0008G21
P008G21
Clone type
BAC
Contamination
none
Estimated length
105,646
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found