Clone Read LE_HBa0008G21_T7_3401

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008G21_T7_3401
Primer
T7
ID from Seq. Facility
LE_HBa_008_G21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
836 trimmed for vector and quality, 986 raw
Genbank Accession
Sequence
>LE_HBa0008G21_T7_3401 (raw untrimmed)
GGCCTAACTGGTTACCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATAAATCAATTAACAAGAATAACTTCATTCAAGCATACACTCTAG
TCTACTTCAGATAATCACTTCATAAGGCACATTTAACAAGAATGACATATTTATCATCCTACTTCACATAACAAGACTTAATAACCTCATTCACAATAAA
CTAGTAAATTTACATTCATACAATTCAAGTAAACACCCCCACCAAGAAGGTGGACCACACCACTCAAGAGCATTTCGAAATTAAAGCTAAACAACATAAT
CAACTTATGCTTTCATCCAATTATTAATCACATACAACATTTTACTCAATATTTCATCATAATAAAGCCCTTTGGGCAGTATCTAAACAACAATAACAAC
CATATGAAACTAAAACTTGAAGACTACCAATTCATGCTCATTTAACACATTTCCTAAGTCAAAATTTGATGAAAATCTTTAACATGATTTCGTTGAAGTT
TTAAACTTAAAATAATCAAGTAACATTAGAAAATACCTTTATTAAGTCATTAGAAACATTTTCATGCAAGACCCATATTAATATTTGAAGATGGTAGAAA
CTGCGGTTGGAAACCTTTTTTGAAAATTCATTAGAAGGGATTTCTTGAATGGAAGAAAGTTCAAGGATGCATAACATACCTCACATTGAATAAATATCAG
TGATATTTTATGAAGAATCGATCATCAACAGCCCTCCTAGAGCTTCTTGGCTTCTAGCTTCCATAGTGACTTGAGAGAGTCTTCTAACAGAGAGGGGTTT
TGGGTTTTAGGAAGAGGAGTCTAAAATGAGATCTTAGGGTTTAGAAAACTTTTATATATCGAATAAAACCTAAATAAACGTCCTAGGGTATAAAACACTA
GGGGTGATTTACAAACACCCAAGCCAAGTAGATTTCACACTTTGAAGCCTCAAGACAAACCTACAATGGACGTCTGCCATTTCGAT
>LE_HBa0008G21_T7_3401 (trimmed for quality and cloning vector)
AGCTTCATAAATCAATTAACAAGAATAACTTCATTCAAGCATACACTCTAGTCTACTTCAGATAATCACTTCATAAGGCACATTTAACAAGAATGACATA
TTTATCATCCTACTTCACATAACAAGACTTAATAACCTCATTCACAATAAACTAGTAAATTTACATTCATACAATTCAAGTAAACACCCCCACCAAGAAG
GTGGACCACACCACTCAAGAGCATTTCGAAATTAAAGCTAAACAACATAATCAACTTATGCTTTCATCCAATTATTAATCACATACAACATTTTACTCAA
TATTTCATCATAATAAAGCCCTTTGGGCAGTATCTAAACAACAATAACAACCATATGAAACTAAAACTTGAAGACTACCAATTCATGCTCATTTAACACA
TTTCCTAAGTCAAAATTTGATGAAAATCTTTAACATGATTTCGTTGAAGTTTTAAACTTAAAATAATCAAGTAACATTAGAAAATACCTTTATTAAGTCA
TTAGAAACATTTTCATGCAAGACCCATATTAATATTTGAAGATGGTAGAAACTGCGGTTGGAAACCTTTTTTGAAAATTCATTAGAAGGGATTTCTTGAA
TGGAAGAAAGTTCAAGGATGCATAACATACCTCACATTGAATAAATATCAGTGATATTTTATGAAGAATCGATCATCAACAGCCCTCCTAGAGCTTCTTG
GCTTCTAGCTTCCATAGTGACTTGAGAGAGTCTTCTAACAGAGAGGGGTTTTGGGTTTTAGGAAGAGGAGTCTAAAATGAGATCTTAGGGTTTAGAAAAC
TTTTATATATCGAATAAAACCTAAATAAACGTCCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.932561
Expected error %
0.379795
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008G21
Clone
Clone name
hba-8g21
LE_HBa0008G21
C12HBa0008G21
P008G21
Clone type
BAC
Contamination
none
Estimated length
105,646
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found