Clone Read LE_HBa0106D10_SP6_34338

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106D10_SP6_34338
Primer
SP6
ID from Seq. Facility
LE_HBa_106_D10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
417 trimmed for vector and quality, 818 raw
Sequence
>LE_HBa0106D10_SP6_34338 (raw untrimmed)
GCCCATCATTCTGCGGGCCAAGTAGACAAAAGAATATGCAGATCGAAAGGTTAGAGACTTAGAGTTCATGGAAGGTGAACAAGTCTTGTTGAAAGTTTCG
CCCATGAAAGGGGTGATGCGGTTTGGAAAAAGGGGTAAACTAAGTCCAAGGTACATTGGACCATTTGAAGTACTCAAGCGAGTAGGGGAGGTGGATTATG
AGTTAGCCTTTCCCCCAGGGCTGTCCGGAGTACATCTGATAGTCCATGTGTCGATGTTGAAAAGATACCACGGGGATGGAAACTACATTATCCGTTGGGA
TTTAATTTTGCTTGATGAGAACTTGTCTTATGAGGAGGAGCTTGTTGCTATTTTAGATAGAGAAGTTCGCAAGTTGAGGTCAAGAGAGATTGCATCCATC
AAGGTGCAATGGAAGAATCTACCGGTTAAAGAATCCACTTGGGAGAATGAGGCGGATTTGCTAGAAAAATAACCTCTTCTGTTTACTGATTCCGGTACTC
CTTTTATCCCTAGTTGACTTTCTCTTTTTCGTTTGGGGACTGAACGATGGGCTATTTCTTACCTCCTTTAACACCTTTTCACTCTCTTTTATCATCTGTT
TTCTCTTTCATATAATCTGGTTATTTTTATTGCTCCTCTTTCTTATTTCCCGTACTGTGCCTCTGTTTGTGTACCCCTTTCCATATCTAAATTTTATTAT
TACTTAAATCTAAATTTCCTACATATTCTTGTAGAACACGTCCCTTATTGCTCATATTTATACTTGTATTTTTTTTCATAACCTATCTTTCCTCTTTCTT
TTTCGCTCTTACATTTTT
>LE_HBa0106D10_SP6_34338 (trimmed for quality and cloning vector)
AAAAGAATATGCAGATCGAAAGGTTAGAGACTTAGAGTTCATGGAAGGTGAACAAGTCTTGTTGAAAGTTTCGCCCATGAAAGGGGTGATGCGGTTTGGA
AAAAGGGGTAAACTAAGTCCAAGGTACATTGGACCATTTGAAGTACTCAAGCGAGTAGGGGAGGTGGATTATGAGTTAGCCTTTCCCCCAGGGCTGTCCG
GAGTACATCTGATAGTCCATGTGTCGATGTTGAAAAGATACCACGGGGATGGAAACTACATTATCCGTTGGGATTTAATTTTGCTTGATGAGAACTTGTC
TTATGAGGAGGAGCTTGTTGCTATTTTAGATAGAGAAGTTCGCAAGTTGAGGTCAAGAGAGATTGCATCCATCAAGGTGCAATGGAAGAATCTACCGGTT
AAAGAATCCACTTGGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959686
Expected error %
0.468644
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 172 E Value 3e-42 Identity 19.30% Align. Length 413bp (99.04%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 169 E Value 2e-41 Identity 19.10% Align. Length 413bp (99.04%) Frame 3
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106D10
Clone
Clone name
hba-106d10
LE_HBa0106D10
P106D10
Clone type
BAC
Contamination
none
Estimated length
97,102
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found