Clone Read LE_HBa0106D10_T7_34339

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106D10_T7_34339
Primer
T7
ID from Seq. Facility
LE_HBa_106_D10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
489 trimmed for vector and quality, 898 raw
Sequence
>LE_HBa0106D10_T7_34339 (raw untrimmed)
TTTAAGTTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGAGGAAAGTTTTCATAAATCGAAGAAGTGGTTGAATATTGTCCC
AGTTTTGACCTTATCGGAAGGTACTCAAGGTTTTGTAGTGTATTGTGACGCATCTAGAGTTTGTTTGGGCTGCGTGTTAATACATTATGTCAAAGTTATA
GTTCATGCCTCAAGACATTTGAAGGTACATAAGAAGATTACCCAACCCATGACTGAGAGTTGACTGGCCTAGTTTTGTTTTGAAGATACATCATCATTAT
TTATATGGTGTGCATGTAAATGTGTTCACCAATCACAAGATCCTTCATTATGTGCGTACTAAGAAAGAGCTTAATCTTAGGCAGAGAAGGTAGTTAGAGT
TACTCAAAGATTATGACGTGAGTATTCTTTACCACCCATGTAAGGCTAATATTGTTGTTCATGCTTTGATCTTGTTGTCTATAGGTAGTACCTCCCATGT
TGAAGAAGAAAAGAAGAGAGTTCACTAAATACGTGCATATACTTCAAAGCTTCGGATTACCACTAATGTGATTCCATCAAATGATGATCATTTGGTTAAG
AATGGGGAGTAATATTTCTTATTTCATATCAATTTTATCTCTTTTCTATTTTCTTTATTTTTTCCTCTAATTTTTTTATAGAAGCCATTCCTCGTTGTCT
TGTATTTTCTTCTATTACATTTTTTTATGTTTTATGTTTTTTATTCTCCTACATCTTAGTCGTCTTATTTTCTCTGTTCTTTCTCTTTTCTTATTTTCAT
ATATTTTATTTTCTTTCTGTTTCTGATTTCTTAGTTCTTTTATTCGTTTATTTTCAATTCGTGTGTTTTAGGTATCTATCTCCAAGAAATAACAACAA
>LE_HBa0106D10_T7_34339 (trimmed for quality and cloning vector)
AGCTTATGAGGAAAGTTTTCATAAATCGAAGAAGTGGTTGAATATTGTCCCAGTTTTGACCTTATCGGAAGGTACTCAAGGTTTTGTAGTGTATTGTGAC
GCATCTAGAGTTTGTTTGGGCTGCGTGTTAATACATTATGTCAAAGTTATAGTTCATGCCTCAAGACATTTGAAGGTACATAAGAAGATTACCCAACCCA
TGACTGAGAGTTGACTGGCCTAGTTTTGTTTTGAAGATACATCATCATTATTTATATGGTGTGCATGTAAATGTGTTCACCAATCACAAGATCCTTCATT
ATGTGCGTACTAAGAAAGAGCTTAATCTTAGGCAGAGAAGGTAGTTAGAGTTACTCAAAGATTATGACGTGAGTATTCTTTACCACCCATGTAAGGCTAA
TATTGTTGTTCATGCTTTGATCTTGTTGTCTATAGGTAGTACCTCCCATGTTGAAGAAGAAAAGAAGAGAGTTCACTAAATACGTGCAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.953533
Expected error %
0.670837
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 92 E Value 3e-27 Identity 54.20% Align. Length 471bp (96.32%) Frame 3
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 87 E Value 4e-34 Identity 49.40% Align. Length 471bp (96.32%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106D10
Clone
Clone name
hba-106d10
LE_HBa0106D10
P106D10
Clone type
BAC
Contamination
none
Estimated length
97,102
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found