Clone Read LE_HBa0106E01_SP6_34368

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106E01_SP6_34368
Primer
SP6
ID from Seq. Facility
LE_HBa_106_E01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
751 trimmed for vector and quality, 871 raw
Sequence
>LE_HBa0106E01_SP6_34368 (raw untrimmed)
CTAAATTTAACAAAAGGGCGAAAGGGACCAACAAAAGGGATCGGTAGGGGACCTTGGGCGAAAGGCAGTTATTAAAGCCCTTAAATCTAAAACTTCCGTA
ACCGGATCTCTTGGAAGGACCTAAAAAGATACATCATCAAGAATCAAGAAATCACCTTCCACATTTCAGAAGAGCAAAGCTGACAAGGTATGAACAATCT
TGTACTAAATATATACTTTTTCCTGTTCTTTTCACCTGTCATTGTTATTATTATGATAATTTAATTCTCTCTCAACGTTACTAACAGGACGAGGAGAGTC
GAAAGAAATTAGAACAATCATTATTGCAACGTCAAAAGAGAATCGCAGAAAGAAGTGGTGCCACTGGTTTAACCAAACCAACATCAAGGAAGAATCCAGC
CACATCTTCAACAATTGAGAAATCAAAACCTGAGGCAACCAATAGATTACAAAAAACAGTTTTTAAGAGTTCCACTATAGAGCGTCTCGCGTCTACAACT
ACAAGGACAGCTAAGGATCGATCCACTGACTCAAAAACCACTCCAAGCAGGAAAGCAAGTCGAAAGGAGAACAAAGTGATTGCTCCAACAAAGAAATCAG
CTGGAAAAGAGAGTACTAAGCAAGGTCCCCGTAAGTCCAAGCCTTCGGATACTAAAGGCCACTCTTCATCTGAACCTCCTCAGAAGGAAAAAGATAGCAA
CACTGGAGTAAACTCAATGTTAAACGAACGTGGAGCAGAACTGAGTCCACAAGTATCTAGTGAAGTCCGTTGATGCTAAGAACACGGGAGAGGTTCGTAG
CTTATCATTAATCGAGAAAAAGATAGATACCACTATGATTTCGGCTGAACTTCCAATGCATGACAAGGAAC
>LE_HBa0106E01_SP6_34368 (trimmed for quality and cloning vector)
GACCAACAAAAGGGATCGGTAGGGGACCTTGGGCGAAAGGCAGTTATTAAAGCCCTTAAATCTAAAACTTCCGTAACCGGATCTCTTGGAAGGACCTAAA
AAGATACATCATCAAGAATCAAGAAATCACCTTCCACATTTCAGAAGAGCAAAGCTGACAAGGTATGAACAATCTTGTACTAAATATATACTTTTTCCTG
TTCTTTTCACCTGTCATTGTTATTATTATGATAATTTAATTCTCTCTCAACGTTACTAACAGGACGAGGAGAGTCGAAAGAAATTAGAACAATCATTATT
GCAACGTCAAAAGAGAATCGCAGAAAGAAGTGGTGCCACTGGTTTAACCAAACCAACATCAAGGAAGAATCCAGCCACATCTTCAACAATTGAGAAATCA
AAACCTGAGGCAACCAATAGATTACAAAAAACAGTTTTTAAGAGTTCCACTATAGAGCGTCTCGCGTCTACAACTACAAGGACAGCTAAGGATCGATCCA
CTGACTCAAAAACCACTCCAAGCAGGAAAGCAAGTCGAAAGGAGAACAAAGTGATTGCTCCAACAAAGAAATCAGCTGGAAAAGAGAGTACTAAGCAAGG
TCCCCGTAAGTCCAAGCCTTCGGATACTAAAGGCCACTCTTCATCTGAACCTCCTCAGAAGGAAAAAGATAGCAACACTGGAGTAAACTCAATGTTAAAC
GAACGTGGAGCAGAACTGAGTCCACAAGTATCTAGTGAAGTCCGTTGATGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957716
Expected error %
0.375577
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g27430.1 Score 65 E Value 3e-11 Identity 11.40% Align. Length 473bp (62.98%) Frame 3
68417.m03942 COP1-interacting protein 7 (CIP7) identical to COP1-Interacting Protein 7 (CIP7) GI:3327868 from [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106E01
Clone
Clone name
hba-106e1
LE_HBa0106E01
P106E01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found