Clone Read LE_HBa0106E01_T7_34369

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106E01_T7_34369
Primer
T7
ID from Seq. Facility
LE_HBa_106_E01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
589 trimmed for vector and quality, 876 raw
Sequence
>LE_HBa0106E01_T7_34369 (raw untrimmed)
CCTAACCTGGTACCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCTATTACCAGTGGTGAGTCCACTCTTACACCTTGTCTTCATTTGA
CCACTCGCTCTCAAAATTTACTTAGCTCATTAAACATTCTGCAGATGTTCCCGAAGGATGTGTTATTATAAAGGAGCATATTCCCATCACAAATCTGTTC
ACCTGTCTGTGGTTCAATGAAGTTGACCGTTTTACCTCTAGGGACCAACTGAGCTTTTCCACTGTCAGGGACAAATTGATGGCAAAAGTTAGCTGGAACG
TCAACATGTTTTTGGATTGTGAGAGGCGAAATTTCGTGATACAGGTATCCATCCACAAGGGAAAATCCCCCCTTACGTTGGATACAATGTTTTACGGTTT
AGCTTAGTTACTTGCCTTAATTTTTGCTGTTCAGTACATACAATACTTTCGCATAGTAAAAGAGCATATACCAAATCTATGCAGGCATACCACAGAGATT
TACTGGAGCAAAGGGCTCACATGACAGTAGTGAGAAGTCGTGCACATCCTCCACCGGCTTTGGTTCGTGATAGTTCTTCTAGTAAACCTCCTGTAAGGAG
ACCTCCAAAGCGCTCAAAAGGTGAAAGGAAGTCTAACTCAAGGCGAACTCTTAAAAGTTTGGGTCTGGGTATAAGGTAAACAGCTATACAATTAGATCTT
CTCTCCCTCCCTCTCTTTCCTCTCTGACTCCGCCTGAATCACTCTGTCTATCTCGTTTTTCCTTCTCTTTCCCCGATACAACATCTTGTTTTGGATTGCT
TTATAGTGCTTCTTTCTCGCCGTATACTTTCTTATTATTTCTTTTCTTTCCTTTTCTTCACCCTCTTCTCATTTTC
>LE_HBa0106E01_T7_34369 (trimmed for quality and cloning vector)
AGCTTCCTATTACCAGTGGTGAGTCCACTCTTACACCTTGTCTTCATTTGACCACTCGCTCTCAAAATTTACTTAGCTCATTAAACATTCTGCAGATGTT
CCCGAAGGATGTGTTATTATAAAGGAGCATATTCCCATCACAAATCTGTTCACCTGTCTGTGGTTCAATGAAGTTGACCGTTTTACCTCTAGGGACCAAC
TGAGCTTTTCCACTGTCAGGGACAAATTGATGGCAAAAGTTAGCTGGAACGTCAACATGTTTTTGGATTGTGAGAGGCGAAATTTCGTGATACAGGTATC
CATCCACAAGGGAAAATCCCCCCTTACGTTGGATACAATGTTTTACGGTTTAGCTTAGTTACTTGCCTTAATTTTTGCTGTTCAGTACATACAATACTTT
CGCATAGTAAAAGAGCATATACCAAATCTATGCAGGCATACCACAGAGATTTACTGGAGCAAAGGGCTCACATGACAGTAGTGAGAAGTCGTGCACATCC
TCCACCGGCTTTGGTTCGTGATAGTTCTTCTAGTAAACCTCCTGTAAGGAGACCTCCAAAGCGCTCAAAAGGTGAAAGGAAGTCTAACT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978971
Expected error %
0.413995
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g28240.1 Score 129 E Value 1e-30 Identity 26.60% Align. Length 206bp (34.97%) Frame 3
68414.m03466 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53040.2 Score 125 E Value 2e-29 Identity 26.20% Align. Length 209bp (35.48%) Frame 3
68414.m06006 expressed protein contains Pfam profile: PF04765 protein of unknown function (DUF616)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF98431.1| Score 129 E Value 5e-29 Identity 26.60% Align. Length 206bp (34.97%) Frame 3
Unknown protein [Arabidopsis thaliana] ref|NP_174145.1| expressed protein [Arabidopsis thaliana] pir||E86408 F3H9.11 protein - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL32582.1| Score 129 E Value 5e-29 Identity 26.60% Align. Length 206bp (34.97%) Frame 3
Unknown protein [Arabidopsis thaliana] gb|AAN72102.1| Unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106E01
Clone
Clone name
hba-106e1
LE_HBa0106E01
P106E01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found