Clone Read LE_HBa0106G05_SP6_34472

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106G05_SP6_34472
Primer
SP6
ID from Seq. Facility
LE_HBa_106_G05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
552 trimmed for vector and quality, 873 raw
Sequence
>LE_HBa0106G05_SP6_34472 (raw untrimmed)
GGCCGAGTATGGTTCTCACTTTTTTTGTACGTATGGTTGTTGTTCAATATCTTCCAGTATTATCATTTCTTTTGTTAATCCTATCTTTAGTACTTTATCG
CAGGTTTTATCTCCACGTATAATATCTCTGTTGTTGTTGTATAAAATTTTACATAGAATAAATTTCCCTTAGTAACTCTCTTATAAGTAATAAATGCTTT
ATGTATCTCCGGCATTCCACTTAGTTCCTCTCTGTCATATGTATATACTGTATTTAGTAATCCATAGTTGTAACATGTCCTCACTAAGTTGGCGTTAGTT
TTTGTTTGTGCAATCAATTTATTATAACCTTGTACTTTTTGGGTTAAATAATCCTGGTTGTGTTCTTTGGTTGTAGTAGATCTGGGTTTAAGGTTTAAAA
ACTTTTGGATTTTGTATATATTTTCTATATAGATTCGCGTAATATGGTTATTTGTTTTTTTTTCATGGTGTAGACTATCTGCGTATGTAGAAGTTTGTGG
TTCTGTAGTTAATATTTTTTTGGTGTTAGCCTCTAGGTAAATAGTATTTCGAATAATTAGTTTAATTTTGAATTCCTATGTTTTTACCTAACTCATTCGG
CTTGTACCTGCAGCTGTATTTAAACAATTGTTATGTGTTTTTAGTGTTTCTCCAACATGCAAGTTTATATTTTGGATTTTTTATGTTTTCTGAATGAAAT
ATTCTCTACACTTATCATGCTATGTGCTCTCTTTATCATCCTCAAATCTTTTTTTCACTTTTTTTTTTTTTCTAGTTTCTTTCCATTTCTCCCTTTATTT
ACCACACTCAGCCTCCACTTCTCATCTTCTTTCTTATTATCATCTTTCCCTGTGTTCTCTTCTAATTAGGTTA
>LE_HBa0106G05_SP6_34472 (trimmed for quality and cloning vector)
TATGGTTGTTGTTCAATATCTTCCAGTATTATCATTTCTTTTGTTAATCCTATCTTTAGTACTTTATCGCAGGTTTTATCTCCACGTATAATATCTCTGT
TGTTGTTGTATAAAATTTTACATAGAATAAATTTCCCTTAGTAACTCTCTTATAAGTAATAAATGCTTTATGTATCTCCGGCATTCCACTTAGTTCCTCT
CTGTCATATGTATATACTGTATTTAGTAATCCATAGTTGTAACATGTCCTCACTAAGTTGGCGTTAGTTTTTGTTTGTGCAATCAATTTATTATAACCTT
GTACTTTTTGGGTTAAATAATCCTGGTTGTGTTCTTTGGTTGTAGTAGATCTGGGTTTAAGGTTTAAAAACTTTTGGATTTTGTATATATTTTCTATATA
GATTCGCGTAATATGGTTATTTGTTTTTTTTTCATGGTGTAGACTATCTGCGTATGTAGAAGTTTGTGGTTCTGTAGTTAATATTTTTTTGGTGTTAGCC
TCTAGGTAAATAGTATTTCGAATAATTAGTTTAATTTTGAATTCCTATGTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.892339
Expected error %
0.196198
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC88782.1| Score 218 E Value 7e-56 Identity 22.80% Align. Length 455bp (82.43%) Frame 3
putative translation transactivator/inclusion body protein [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC88793.1| Score 216 E Value 3e-55 Identity 22.60% Align. Length 455bp (82.43%) Frame 3
putative translocation transactivator/inclusion body protein [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106G05
Clone
Clone name
hba-106g5
LE_HBa0106G05
C03HBa0106G05
P106G05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found