Clone Read LE_HBa0106G05_T7_34473

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106G05_T7_34473
Primer
T7
ID from Seq. Facility
LE_HBa_106_G05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
660 trimmed for vector and quality, 899 raw
Sequence
>LE_HBa0106G05_T7_34473 (raw untrimmed)
ATTAGACCTGGTCCGTGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCATTTAATTGTTGATTCAAATGCTTGATACGCTCCGAAAAAATTAG
TGTTATCATATTCTGAATGTATTATTTTTCAATTTATTTTTTTTATACATAAATTCTAAGATTGTTTATTCAGTGGTTACCACTAATGTAAGTCATGATA
CACTAGTAATAAACGACAGACGTGTATTGTAATTTTGTATCTATGGATTATGATATGGTCATTATTGATATTTGATTGTGAATTGTATAAAAATGTATCA
TCTTAATAAATTGTATATGATCAATTATATTGCATATGATATAAAATTATGAATATAACAACACATTCAATAATATGAACTTTATACATGATACATTCAT
AAGAACTATTTAAAAATTACAAAATTAAAGTCGAGTTATAACCATCAAAATTACGTATATGTTACATAATTTAGACTACAAATTATCTAATTGTTTGTTT
GCTACATAGTTATAAGAAAATGTATTTGATATTCATTTAAGGTAAATAAGTTAGGTTTTATGTTTAACTATTTAAAAATATAATACAATGTTCTACTGAT
TACATTCCAGTATATAATTTGAACTTTATATGAAATTATTAACTATTTTAGAAATATAATCATACACCATTATGTTTGTAAATATGGTATCACTCAATAT
GTTTCAAACACATTTTTTAGAAGAGTGTAACATTTTCATTTGTAATGGTTCATTTATGTATCTTATTTCTTAATGTTCTGTATTTAATATTTTAAGTTTT
CTTTATTTAATTGTTTTTTTAAATTGTTCTCCATAAATTATATTAATTTACCTTTCATGTACTTCATGAGTTTTCCTCTAATTACATTTGATATTCTCC
>LE_HBa0106G05_T7_34473 (trimmed for quality and cloning vector)
AGCTTCCATTTAATTGTTGATTCAAATGCTTGATACGCTCCGAAAAAATTAGTGTTATCATATTCTGAATGTATTATTTTTCAATTTATTTTTTTTATAC
ATAAATTCTAAGATTGTTTATTCAGTGGTTACCACTAATGTAAGTCATGATACACTAGTAATAAACGACAGACGTGTATTGTAATTTTGTATCTATGGAT
TATGATATGGTCATTATTGATATTTGATTGTGAATTGTATAAAAATGTATCATCTTAATAAATTGTATATGATCAATTATATTGCATATGATATAAAATT
ATGAATATAACAACACATTCAATAATATGAACTTTATACATGATACATTCATAAGAACTATTTAAAAATTACAAAATTAAAGTCGAGTTATAACCATCAA
AATTACGTATATGTTACATAATTTAGACTACAAATTATCTAATTGTTTGTTTGCTACATAGTTATAAGAAAATGTATTTGATATTCATTTAAGGTAAATA
AGTTAGGTTTTATGTTTAACTATTTAAAAATATAATACAATGTTCTACTGATTACATTCCAGTATATAATTTGAACTTTATATGAAATTATTAACTATTT
TAGAAATATAATCATACACCATTATGTTTGTAAATATGGTATCACTCAATATGTTTCAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.86953
Expected error %
0.743412
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106G05
Clone
Clone name
hba-106g5
LE_HBa0106G05
C03HBa0106G05
P106G05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found