Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0106G10_SP6_34482

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106G10_SP6_34482
Primer
SP6
ID from Seq. Facility
LE_HBa_106_G10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
600 trimmed for vector and quality, 880 raw
Sequence
>LE_HBa0106G10_SP6_34482 (raw untrimmed)
ATTCCTTTGGCTTGTTGAGCACCACTGTCAAGATCTTAACATACACCTTGATGGCCTCTTAGCAGTGACTCTCTGGTAACCTACAGAAGCATCCCAATCC
AGAGGGTTAATTACACAGCCAGGATTAAAGTTGGCCTCCCCCTATCAAACTAACAATTTCATTCGTACTCTATTCTCCAGCCTTCCATTTCCTTCCTTTA
TGAAGAAAATGGTTGGGTATGTGTGGTGTTAGCCATGAGGAATGACTTGAAAATCATAATCTCTAATCCTTAAGCTACCAAACGGGAACTAGAAACTATT
TTTCTCGCAAACAGCAAGGTAAGAATATTCCTTTTATCTTTGATGAAGACCTCAACTACACTATAACATTGAGACAGAAGACAAAGGTACATACCGCCAT
GGGAATTCACTTGTGTCAATTCCAGCTTGGTGAAGTTCATCAACATACTGTAAAGCTTCTCTACATTCCTCACGATCATCAAAAAATTCTCTCTTCTCAC
CTTCTATTTGGAATGCTTCATGGCCTTTGCCAGCAACCACCTGCAGGGTGGTTAATAGGAACTGAATTAAACAACACAAATAAAATTGAATTGCCTGGTG
AGCACTTCTATTATGAATATCTTTTACCCTTATAAGTTGTAGCTTGTACCATCAGTTATATTTTAAAAACAAATAACAATGATGGTGAAGAAGAATGGAG
ACTAGGAACTTACAATTATATCTCCTTCTTTACTCATGGTAACCTCACCTCCTCCAGCTACTCGATTGATACATTGATCAAACATCTTATCTGCATTGGG
GAGATGTGGTTTACTATAAGCTCTTAGATGATTTTCTTATCTTAATCGTCTACTTACTTATACAATAATATATATTTATT
>LE_HBa0106G10_SP6_34482 (trimmed for quality and cloning vector)
TGTCAAGATCTTAACATACACCTTGATGGCCTCTTAGCAGTGACTCTCTGGTAACCTACAGAAGCATCCCAATCCAGAGGGTTAATTACACAGCCAGGAT
TAAAGTTGGCCTCCCCCTATCAAACTAACAATTTCATTCGTACTCTATTCTCCAGCCTTCCATTTCCTTCCTTTATGAAGAAAATGGTTGGGTATGTGTG
GTGTTAGCCATGAGGAATGACTTGAAAATCATAATCTCTAATCCTTAAGCTACCAAACGGGAACTAGAAACTATTTTTCTCGCAAACAGCAAGGTAAGAA
TATTCCTTTTATCTTTGATGAAGACCTCAACTACACTATAACATTGAGACAGAAGACAAAGGTACATACCGCCATGGGAATTCACTTGTGTCAATTCCAG
CTTGGTGAAGTTCATCAACATACTGTAAAGCTTCTCTACATTCCTCACGATCATCAAAAAATTCTCTCTTCTCACCTTCTATTTGGAATGCTTCATGGCC
TTTGCCAGCAACCACCTGCAGGGTGGTTAATAGGAACTGAATTAAACAACACAAATAAAATTGAATTGCCTGGTGAGCACTTCTATTATGAATATCTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957636
Expected error %
0.604836
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g63680.1 Score 64 E Value 6e-11 Identity 21.80% Align. Length 146bp (24.33%) Frame 1
68414.m07206 Mur ligase family protein contains Pfam profile: PF01225 Mur ligase family, catalytic domain
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106G10
Clone
Clone name
hba-106g10
LE_HBa0106G10
C08HBa0106G10
P106G10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found