Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0106G10_T7_34483

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106G10_T7_34483
Primer
T7
ID from Seq. Facility
LE_HBa_106_G10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
151 trimmed for vector and quality, 826 raw
Sequence
>LE_HBa0106G10_T7_34483 (raw untrimmed)
TTAGTTTGGGTCCCGGGGGGACCTTCTANGAGTCGACCTCGCAGGCTAGCAAGCTTACCTTACAGCAGAAATAGGTACCTGGAGGGAGTTGTTGTCTACC
TCTTTCGAAATCATCGATAACCTTCTCACTCTGACGAGAATAAATTGTTGGAGTTTCAATGTTTCTAGGCACACATTTGGTAAATCCAGGGGGTATTTCT
GAAAAATAATTTTTATCTGTCATTGTTGAGATTTTTTTTTAGTCCATAGATTGTAGATTCTAGTGAGCCACTTTGAACGTTTATTATAATGTTAATATTT
CTCTCATGTTTAATATTTTTTTTTGTGTTTTATTTATGTTGTTTGGGTGTTATGTGAACGGTGATATGTCACCCCATGCTTTTTTTCGACTATCTTTGTG
TATATTTATATTTTTTCATTTTTTTTTTATTGTTTTTTATTTTTATTTTTGTATCTTATTATCTCTCTTATCTTCTCCCCCGTTCCTCACTCGTGTTCCA
TATATATATGCTGTTACATTTAATTTCCTCTCTTTGTTAGTATGGTGCTTTGTTTTGTACTATATCAATTTCTTCTGTCTGTACTGTTATTGTGTCCTAC
TTGCTTGTCCCTCCGCCCGGCTGTATATTAATGCAAATGTATGTATCTTAGTTTGTATTATAATCTTTTTATTTTTTTTCTGTTCTATGTATTCTGTCTC
ATAAACCTGTGTCTTAGAGCTTGACTTATAAATTAGGTTTATTTATTGTGTCTTGCTGTATTTTTTGTTTAATCTTTTTTAGTCTNTNCAGGGAGGGAGA
GGGGGGGGAGGGGGGGAGGGGGGGNN
>LE_HBa0106G10_T7_34483 (trimmed for quality and cloning vector)
GAGTTGTTGTCTACCTCTTTCGAAATCATCGATAACCTTCTCACTCTGACGAGAATAAATTGTTGGAGTTTCAATGTTTCTAGGCACACATTTGGTAAAT
CCAGGGGGTATTTCTGAAAAATAATTTTTATCTGTCATTGTTGAGATTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.913955
Expected error %
1.01923
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106G10
Clone
Clone name
hba-106g10
LE_HBa0106G10
C08HBa0106G10
P106G10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found