Clone Read LE_HBa0106H12_T7_34535

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106H12_T7_34535
Primer
T7
ID from Seq. Facility
LE_HBa_106_H12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
784 trimmed for vector and quality, 911 raw
Sequence
>LE_HBa0106H12_T7_34535 (raw untrimmed)
ATAACCCGGGTCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAATGGCTGAAAGCTGGGATGGGTTTCATGATCCTGGTAGCCCGTC
TGAGGAGAGTTACCATCTCGAGAGACTGCACATAGAACCAATTTATGATGCATTCATATGCCCTTTGACAAAACAAGTAATGCAGGATCCTGTTACTCTG
GAAAATGGCATGACTTTTGAGAGGGAAGCTATTGAGAAATGGTTCAAGGAGTGTAGGGATAGTGGAAGAAAGCCTGTTTGCCCTTTAACACATAGAGATC
TGAAAAGCACAGAGCTGAATCCAAGTATAGCTCTACGAAATACCATTGAAGAATGGAATGCAAGGAATGAAGCTGCACAAATTGATATGGCTCGCAGATC
ATTATCTATGGGTAGTGCGGAGGGTGATATTATGCAGGCTTTAAAGTTTGTTCAGCACCTTTGCCAAAAAAGTCGCGCCAACAAACATGTTATCAGGAAT
GCAGATCTCATACCCATGATTGTAGACATGTTAAAAACCAGTAGCCGCAGAGTTCGATGTAAAGCTCTTGAAACGCTTCTAGTTGTGGTAGAGGACGATG
ATGACAATAAGGTTGTAGAACTTCGGTAAAATAATATTTATGTTGTTACCAAAGTCTGTTTTATGATGTTGATTATTCCTACTGTTTATGTTTTCCCTTA
TTAATTTTTTCTCTTTCGTTATATGCCCTGCTCCTTTCTTGCAGGAAACAATGGCTGAAGGCGACAATGTACCCACAATAGTCAAATTCTTATCCAATGA
ACAATCCAAAAAAAGAAAGGCAGCCTTTTCTTTTCCTCGTATAACTATCCAATTCAAAAATTGTGCCGAAAAATCGTTTCATTATATGGCGCCTTTTAAC
GTTTTCTCGGA
>LE_HBa0106H12_T7_34535 (trimmed for quality and cloning vector)
AGCTTTAATGGCTGAAAGCTGGGATGGGTTTCATGATCCTGGTAGCCCGTCTGAGGAGAGTTACCATCTCGAGAGACTGCACATAGAACCAATTTATGAT
GCATTCATATGCCCTTTGACAAAACAAGTAATGCAGGATCCTGTTACTCTGGAAAATGGCATGACTTTTGAGAGGGAAGCTATTGAGAAATGGTTCAAGG
AGTGTAGGGATAGTGGAAGAAAGCCTGTTTGCCCTTTAACACATAGAGATCTGAAAAGCACAGAGCTGAATCCAAGTATAGCTCTACGAAATACCATTGA
AGAATGGAATGCAAGGAATGAAGCTGCACAAATTGATATGGCTCGCAGATCATTATCTATGGGTAGTGCGGAGGGTGATATTATGCAGGCTTTAAAGTTT
GTTCAGCACCTTTGCCAAAAAAGTCGCGCCAACAAACATGTTATCAGGAATGCAGATCTCATACCCATGATTGTAGACATGTTAAAAACCAGTAGCCGCA
GAGTTCGATGTAAAGCTCTTGAAACGCTTCTAGTTGTGGTAGAGGACGATGATGACAATAAGGTTGTAGAACTTCGGTAAAATAATATTTATGTTGTTAC
CAAAGTCTGTTTTATGATGTTGATTATTCCTACTGTTTATGTTTTCCCTTATTAATTTTTTCTCTTTCGTTATATGCCCTGCTCCTTTCTTGCAGGAAAC
AATGGCTGAAGGCGACAATGTACCCACAATAGTCAAATTCTTATCCAATGAACAATCCAAAAAAAGAAAGGCAGCCTTTTCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.974366
Expected error %
1.35219
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g20780.1 Score 213 E Value 1e-55 Identity 21.40% Align. Length 476bp (60.71%) Frame 3
68414.m02602 armadillo/beta-catenin repeat protein-related / U-box domain-containing protein low similarity to immediate-early fungal elicitor protein CMPG1 [Petroselinum crispum] GI:14582200; contains Pfam profile PF04564: U-box domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g76390.1 Score 188 E Value 3e-48 Identity 19.00% Align. Length 500bp (63.78%) Frame 3
68414.m08877 armadillo/beta-catenin repeat family protein / U-box domain-containing protein contains Pfam domain, PF00514: Armadillo/beta-catenin-like repeats and Pfam, PF04564: U-box domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_564125.2| Score 213 E Value 6e-54 Identity 21.40% Align. Length 476bp (60.71%) Frame 3
armadillo/beta-catenin repeat protein-related / U-box domain-containing protein [Arabidopsis thaliana] gb|AAF80621.1| F2D10.27 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM20387.1| Score 213 E Value 6e-54 Identity 21.40% Align. Length 476bp (60.71%) Frame 3
unknown protein [Arabidopsis thaliana] gb|AAL24123.1| unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106H12
Clone
Clone name
hba-106h12
LE_HBa0106H12
P106H12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found