Clone Read LE_HBa0106L09_SP6_34720

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106L09_SP6_34720
Primer
SP6
ID from Seq. Facility
LE_HBa_106_L09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
619 trimmed for vector and quality, 899 raw
Sequence
>LE_HBa0106L09_SP6_34720 (raw untrimmed)
GGGCGAGTTATTAAAATTGGAAATTCCCCCTGCTTATGTGGTTGTGTCAATCGAACTTTGCTGGAAGCAAAATTTGTTCCCGTTTAGGGGGCATGTAGGC
AAGAAATGCATGTTTGAATACCCTTTTTGTCGATCAAAAAAGCGGTGGCGCAAAAGGTTTGGTCAATTTTTCCTAGAAGTTCTTTCTTCCTTCTCATCCA
AGTTACCTACTATTCTTGAACTAGATAACATATTACATTGAAAGTCAAGAGAATGAGGAGTTGTTTAGTTCAAGAACTTGTTCAAAGATTTAGAAATAAT
ATAGGGATACAAAATGTTGTGTTATTTACACCGAAATAACATTTGTAATTTAAGTTGTGTTGCAAAACAAATGCCTTGTTACTTATGCAGAATATTGTGG
CAGAATTATATTTTCCTGATGCATCTAACCAAAAAAAACCTTTGTGTACTTCCAATCTTTTGGAGAAAAGCATGTTCAAATTGGTTTTCCTACTTTGGAC
AATGTTTGGTTGAGATTGAAAAACAAGTTTTTGAAGTTCAAGTTTTAAAAAAAGAATATTTGCAAGTTGCAATAGTGTTCGAACATGCATTTCACTTGAG
AAAAAGTTGGAAGTTTTGTGAGTGAATACTATTATTTCACTTGAAATACCCATCTTTTTCACTTCAAATTCCCTATTTCAAGCTGAAGTTTATTAATGGA
TAATATGGTTAAACTTACCTACTTTGACATTATCTATATATTTATCAATGATGATAATACATGATCCAACACCTCAAACTGAGCATTAGCTTATATGAAT
ACACACACCTTACTTCTATTTAAAAACACACTAAAAATTTTCTTACATGTACACAAATATCTATCCTCACAATCACCTCTCCCACTAACCCAACGATTC
>LE_HBa0106L09_SP6_34720 (trimmed for quality and cloning vector)
TGGTTGTGTCAATCGAACTTTGCTGGAAGCAAAATTTGTTCCCGTTTAGGGGGCATGTAGGCAAGAAATGCATGTTTGAATACCCTTTTTGTCGATCAAA
AAAGCGGTGGCGCAAAAGGTTTGGTCAATTTTTCCTAGAAGTTCTTTCTTCCTTCTCATCCAAGTTACCTACTATTCTTGAACTAGATAACATATTACAT
TGAAAGTCAAGAGAATGAGGAGTTGTTTAGTTCAAGAACTTGTTCAAAGATTTAGAAATAATATAGGGATACAAAATGTTGTGTTATTTACACCGAAATA
ACATTTGTAATTTAAGTTGTGTTGCAAAACAAATGCCTTGTTACTTATGCAGAATATTGTGGCAGAATTATATTTTCCTGATGCATCTAACCAAAAAAAA
CCTTTGTGTACTTCCAATCTTTTGGAGAAAAGCATGTTCAAATTGGTTTTCCTACTTTGGACAATGTTTGGTTGAGATTGAAAAACAAGTTTTTGAAGTT
CAAGTTTTAAAAAAAGAATATTTGCAAGTTGCAATAGTGTTCGAACATGCATTTCACTTGAGAAAAAGTTGGAAGTTTTGTGAGTGAATACTATTATTTC
ACTTGAAATACCCATCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.931946
Expected error %
0.839949
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106L09
Clone
Clone name
hba-106l9
LE_HBa0106L09
P106L09
Clone type
BAC
Contamination
none
Estimated length
134,301
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found