Clone Read LE_HBa0106L09_T7_34721

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0106L09_T7_34721
Primer
T7
ID from Seq. Facility
LE_HBa_106_L09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
589 trimmed for vector and quality, 900 raw
Sequence
>LE_HBa0106L09_T7_34721 (raw untrimmed)
TACCTGGGTCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATTATGCACAAGTTTGATGGACACTTTTTTTTAAAAATGGTGCCTTCT
TAAGAAGTGGTTCACATAACTTTATGAACTGTTATAAGCATTTTGCATGTAAGAAGGAAATTTTGAGCTAGTTCTTTCTTAAGTAAAATACTTGAGCTAC
TTCAAAGTTCCCAACTATAATAAAAAGGAACAAGCCAATCACTCACCAGATTTAGCAAGATGCTCCATAAGGACAGTGTATGTGTGGCAGTTGGGAGAAC
AACCAGATTGAAGCATCTCCTTGTATATCTTGGCTCCTTCCTTAACTCGATTATGATCAAATAAACCTTTCATGTATGCAGTGTAGCAAACAACATTAGG
AGCACATCCTTTATCTTTCATATCCTGCCATAATTTAATTGACTCATTAATGTCCCCATGGTCGGAAAGCCAGTGAAGAAGGGATGTATACGTCACTGCA
TCTATCTTGATTTCTTTGTCTTGCATCTGCTGAAAGATATAGTTCATGGATGAAATCCTCCCAGCTTCCCCAAATATATCCAACATAGTCGTGTATGTAA
ACTGGTCATGCTTAAAGCCTTTCAACTCACAGGTCCAATTGAAATATAACCAGGCTTTCCTTCCTGGATGATGGGTCCTTGGAACTATATTAACAGTTAA
CGATTGCTGTTCTACCGGATTTTCCTATATTCTCTCTGTTTTTTCATCTCATCCGTCTATCTCATGCCTTCGTCCATGTTCTGGTTCTGTGCCGGACATC
ATCCTATCCTGTCCCCAATTGTTTGTGGACGGAGTAATTTCTTACATCTGATTGTTTTCTTCTTTCTGTCTTTCACGCTTAAATCATACACTCTGCACTC

>LE_HBa0106L09_T7_34721 (trimmed for quality and cloning vector)
AGCTTAATTATGCACAAGTTTGATGGACACTTTTTTTTAAAAATGGTGCCTTCTTAAGAAGTGGTTCACATAACTTTATGAACTGTTATAAGCATTTTGC
ATGTAAGAAGGAAATTTTGAGCTAGTTCTTTCTTAAGTAAAATACTTGAGCTACTTCAAAGTTCCCAACTATAATAAAAAGGAACAAGCCAATCACTCAC
CAGATTTAGCAAGATGCTCCATAAGGACAGTGTATGTGTGGCAGTTGGGAGAACAACCAGATTGAAGCATCTCCTTGTATATCTTGGCTCCTTCCTTAAC
TCGATTATGATCAAATAAACCTTTCATGTATGCAGTGTAGCAAACAACATTAGGAGCACATCCTTTATCTTTCATATCCTGCCATAATTTAATTGACTCA
TTAATGTCCCCATGGTCGGAAAGCCAGTGAAGAAGGGATGTATACGTCACTGCATCTATCTTGATTTCTTTGTCTTGCATCTGCTGAAAGATATAGTTCA
TGGATGAAATCCTCCCAGCTTCCCCAAATATATCCAACATAGTCGTGTATGTAAACTGGTCATGCTTAAAGCCTTTCAACTCACAGGTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961927
Expected error %
0.512725
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g01390.1 Score 179 E Value 7e-46 Identity 20.70% Align. Length 386bp (65.53%) Frame 2
68415.m00056 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g51965.1 Score 89 E Value 1e-18 Identity 34.60% Align. Length 389bp (66.04%) Frame 2
68414.m05859 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD14538.1| Score 180 E Value 2e-44 Identity 20.70% Align. Length 386bp (65.53%) Frame 2
predicted by genscan and genefinder [Arabidopsis thaliana] pir||A84424 hypothetical protein At2g01380 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_178248.2| Score 179 E Value 3e-44 Identity 20.70% Align. Length 386bp (65.53%) Frame 2
pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0106L09
Clone
Clone name
hba-106l9
LE_HBa0106L09
P106L09
Clone type
BAC
Contamination
none
Estimated length
134,301
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found