Clone Read LE_HBa0110D13_T7_35113

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110D13_T7_35113
Primer
T7
ID from Seq. Facility
LE_HBa_110_D13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
715 trimmed for vector and quality, 806 raw
Sequence
>LE_HBa0110D13_T7_35113 (raw untrimmed)
GCCTTGGTCCCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGCTATAGTAGGTTGTCCACGTGTAGGTAGTTTGAAGCATGTGTCTTTCC
ATTACTCTCTCTTCCTACACCTTAACCAAGATTTCCTCGAAAGTCTATTTTCTTTGGAGGAGCTTCAAGCTCTCTGTAAGTTCACTCATGAAGTTGGATA
AAAGGCATCAAAGGTCATGGTAAGTTCCTTTACTTGTTCTATTTTTTCAAGTTTGGCTTTACTTCTTTCTCCTCTATTTGAATTGTCTCATTCAAGCTTT
TTTATGGAGTTTCTTTGAATGAATTTTTTATTTTAGTTTTGCATGGGTTTAAACTAGAAGTTTCACAAATTGGATTGAAATTTCCACGTAATTAGCATAT
TGTTTCTTAGTTTTAGGTTTGGATCTGATCTTTTGATGATTTTTTCTTTGTGTATATGTTTCCATAGTGTATGCATCTTCAAAAACAATTGGGATGCTTT
CTTAGATAGTGTATCTCTCTATGTTTTTTTTGTTGTTCATTGGTAAGCCCTCCAATTTTACCTTTCTCTGATACGTTTGTAATTTCTTGTGTTTTGCACC
CGTTTATTTCCTTTCATTTATTCATTTGTTCGTACTTAATTTATTCACGAGTAAGCTCTCCAATTCGATCTTATCTCTGATATGTTTGTAATTTCTTTTT
GTGAAAATTTCCTCTGTTATCTTTCCTCCACATGCATATTTTGTTTCATATTTTAATTTTTCTCTTCTTCCTAAAAATTTAGGCCCTCAAACAACTTGTG
CTTTGT
>LE_HBa0110D13_T7_35113 (trimmed for quality and cloning vector)
AGCTTTGCTATAGTAGGTTGTCCACGTGTAGGTAGTTTGAAGCATGTGTCTTTCCATTACTCTCTCTTCCTACACCTTAACCAAGATTTCCTCGAAAGTC
TATTTTCTTTGGAGGAGCTTCAAGCTCTCTGTAAGTTCACTCATGAAGTTGGATAAAAGGCATCAAAGGTCATGGTAAGTTCCTTTACTTGTTCTATTTT
TTCAAGTTTGGCTTTACTTCTTTCTCCTCTATTTGAATTGTCTCATTCAAGCTTTTTTATGGAGTTTCTTTGAATGAATTTTTTATTTTAGTTTTGCATG
GGTTTAAACTAGAAGTTTCACAAATTGGATTGAAATTTCCACGTAATTAGCATATTGTTTCTTAGTTTTAGGTTTGGATCTGATCTTTTGATGATTTTTT
CTTTGTGTATATGTTTCCATAGTGTATGCATCTTCAAAAACAATTGGGATGCTTTCTTAGATAGTGTATCTCTCTATGTTTTTTTTGTTGTTCATTGGTA
AGCCCTCCAATTTTACCTTTCTCTGATACGTTTGTAATTTCTTGTGTTTTGCACCCGTTTATTTCCTTTCATTTATTCATTTGTTCGTACTTAATTTATT
CACGAGTAAGCTCTCCAATTCGATCTTATCTCTGATATGTTTGTAATTTCTTTTTGTGAAAATTTCCTCTGTTATCTTTCCTCCACATGCATATTTTGTT
TCATATTTTAATTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.909074
Expected error %
1.13495
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110D13
Clone
Clone name
hba-110d13
LE_HBa0110D13
P110D13
Clone type
BAC
Contamination
none
Estimated length
109,729
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found