Clone Read LE_HBa0110G14_T7_35259

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110G14_T7_35259
Primer
T7
ID from Seq. Facility
LE_HBa_110_G14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
671 trimmed for vector and quality, 822 raw
Sequence
>LE_HBa0110G14_T7_35259 (raw untrimmed)
TAACTTGGACCGGGCGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGCAAGAATAGACGAAGTTGTGGGTATATGGAATTTATATAGCTGTAAA
TGGTACGGCGACAGTGGATTGCTACCCAAAATTCACCTCTCTCATTTGTGCTGACATTATCAGGATATCCTGGGAGGACTGCCATCACCTCAAAGGTCCC
CGCTTTCTCGCCTTTCAACCAGTACTTCTGTAATCTATAAGAGAAACACATCATTCCATTATATGTTAATACCCCAATTTTTAAGGTGAAGTCAGAAACA
GGATCCTTGTATATCTATTTAATACTGTAAACATGCTAATCCATAGGTCGAGAAACGTACCTTCCCTTGGCAACTTCACAGAATACAAAGAAGGAACCGT
CCTTGCTTAGTGACAGACCGTTTGGGAATTGGAGATTCCGAACAAGAACAGTGGTTTGTTTAGTATTAGAATTGTACTTCAAGACCCTCCCACTATCTTC
TGCTGAGTAAACCAGCAGCATATAGTTCCTGTGCAAGATGGGGTGGGTAGTAATATTCTAATTAAAGAAGAAACGCGCATGACACTTGAACCATGTTGTA
TTAAAACCTGAAATAAATGCTTATATATGGAATTGCAAATCCGATATAAACATCTTCACTATAGTTAGCAGAGTTGGGTATTAATTGAACAGAAGATATG
TTAGCAAAGTTAGGTGCAACCATGTAACCACGTTAAAATCTAAGCTTCTCCAAGAACATCCTATTTCATAAATGTTTATCAAATTTAAGGCTTTAATTCT
CCTTTTTTCTGTCCTAAAATGC
>LE_HBa0110G14_T7_35259 (trimmed for quality and cloning vector)
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGCAAGAATAGACGAAGTTGTGGGTATATGGAATTTATATAGCTGTAAATGGTACGGCGACAGTGGAT
TGCTACCCAAAATTCACCTCTCTCATTTGTGCTGACATTATCAGGATATCCTGGGAGGACTGCCATCACCTCAAAGGTCCCCGCTTTCTCGCCTTTCAAC
CAGTACTTCTGTAATCTATAAGAGAAACACATCATTCCATTATATGTTAATACCCCAATTTTTAAGGTGAAGTCAGAAACAGGATCCTTGTATATCTATT
TAATACTGTAAACATGCTAATCCATAGGTCGAGAAACGTACCTTCCCTTGGCAACTTCACAGAATACAAAGAAGGAACCGTCCTTGCTTAGTGACAGACC
GTTTGGGAATTGGAGATTCCGAACAAGAACAGTGGTTTGTTTAGTATTAGAATTGTACTTCAAGACCCTCCCACTATCTTCTGCTGAGTAAACCAGCAGC
ATATAGTTCCTGTGCAAGATGGGGTGGGTAGTAATATTCTAATTAAAGAAGAAACGCGCATGACACTTGAACCATGTTGTATTAAAACCTGAAATAAATG
CTTATATATGGAATTGCAAATCCGATATAAACATCTTCACTATAGTTAGCAGAGTTGGGTATTAATTGAAC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975631
Expected error %
0.0353806
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|X65332.1:1-115 Score 70 E Value 3e-13 Identity 100.00% Align. Length 34bp (5.07%) Frame 2
Cloning vector pSP72
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|X65333.1:1-122 Score 70 E Value 3e-13 Identity 100.00% Align. Length 34bp (5.07%) Frame 2
Cloning vector pSP73
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g08470.1 Score 159 E Value 2e-39 Identity 16.70% Align. Length 485bp (72.28%) Frame 3
68414.m00938 strictosidine synthase family protein similar to strictosidine synthase [Rauvolfia serpentina][SP|P15324]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g22020.1 Score 150 E Value 6e-37 Identity 15.60% Align. Length 485bp (72.28%) Frame 3
68418.m02562 strictosidine synthase family protein similar to SP|P15324 Strictosidine synthase precursor (EC 4.3.3.2) {Rauvolfia mannii}; contains Pfam profile PF03088: Strictosidine synthase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||H86217 Score 164 E Value 1e-39 Identity 17.10% Align. Length 485bp (72.28%) Frame 3
protein T27G7.16 [imported] - Arabidopsis thaliana gb|AAF22901.1| T27G7.16 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM51389.1| Score 159 E Value 8e-38 Identity 16.70% Align. Length 485bp (72.28%) Frame 3
unknown protein [Arabidopsis thaliana] gb|AAL36403.1| unknown protein [Arabidopsis thaliana] ref|NP_563818.1| strictosidine synthase family protein [Arabidopsis thaliana] gb|AAL31926.1| At1g08470/T27G7_9 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110G14
Clone
Clone name
hba-110g14
LE_HBa0110G14
P110G14
Clone type
BAC
Contamination
none
Estimated length
102,117
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found