Clone Read LE_HBa0110L05_SP6_35480

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110L05_SP6_35480
Primer
SP6
ID from Seq. Facility
LE_HBa_110_L05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
724 trimmed for vector and quality, 823 raw
Sequence
>LE_HBa0110L05_SP6_35480 (raw untrimmed)
ATTGCAATGAACAGAAGTGGAGGCATTCACTCGTAATTTGTCCGTATCGGCACTTAGAATGACGTTTTAAGATTCTGTTAGTATATCAGTAATCCTAGTA
ATTATACTTTAGATTAGTAGAAGTTACTAAAAAAATGAGGAAGCATTTTTCCCTCTTATTATGTATGTTCTCCTATTTGAATACATCTGCAAAAACTATT
TAATCCCCATAACTTGAGGACATGAAACTAAAGAAGTATTGAAAAACACGTCCGAGAGAACATTTTGCTTTCACAGACATAAACTGCATAACTGGTGTCA
ATAATGTATTTCTAACTGTGGAATAGGGCAATAATTTCTTGTTAACTTGACTAAGTAACAACAATGTATGTATTAGAGGTCGTCCTTTATATAATAGTTC
TAGACTACGTACAGTATGGGAAGTATTCAAACCTCTATACTACTAACATAATTTAATCTATAAGATTTTTCTGATTTAAGTACGGCAAATCTAGATATGT
ATGCTTATAAATACAATTTTCTTTATATTCCAACGCTAATTTAACACATAACTACAACAGATTAGGAATATCCATACTGGCTAACACCATGGTTATAAAT
TTTTTTGTATTTGATCCTCAAATATATTTTGTAAGAATATCAAGTAACTAGTCACTAAAATTAAGCAAAACTAGTCAAAACACATATTTTTATTGATAAC
CGTTCCTGAAGGCTAATGATGCACAGTTCAAAACTCGGTGGATAGTGGGCTTACCCCTCTACCCTAGTCACAATACATTTTGGATTCCATCCTTTATCTT
ATAAAAAAACAAATCCTTTTAGT
>LE_HBa0110L05_SP6_35480 (trimmed for quality and cloning vector)
TGGAGGCATTCACTCGTAATTTGTCCGTATCGGCACTTAGAATGACGTTTTAAGATTCTGTTAGTATATCAGTAATCCTAGTAATTATACTTTAGATTAG
TAGAAGTTACTAAAAAAATGAGGAAGCATTTTTCCCTCTTATTATGTATGTTCTCCTATTTGAATACATCTGCAAAAACTATTTAATCCCCATAACTTGA
GGACATGAAACTAAAGAAGTATTGAAAAACACGTCCGAGAGAACATTTTGCTTTCACAGACATAAACTGCATAACTGGTGTCAATAATGTATTTCTAACT
GTGGAATAGGGCAATAATTTCTTGTTAACTTGACTAAGTAACAACAATGTATGTATTAGAGGTCGTCCTTTATATAATAGTTCTAGACTACGTACAGTAT
GGGAAGTATTCAAACCTCTATACTACTAACATAATTTAATCTATAAGATTTTTCTGATTTAAGTACGGCAAATCTAGATATGTATGCTTATAAATACAAT
TTTCTTTATATTCCAACGCTAATTTAACACATAACTACAACAGATTAGGAATATCCATACTGGCTAACACCATGGTTATAAATTTTTTTGTATTTGATCC
TCAAATATATTTTGTAAGAATATCAAGTAACTAGTCACTAAAATTAAGCAAAACTAGTCAAAACACATATTTTTATTGATAACCGTTCCTGAAGGCTAAT
GATGCACAGTTCAAAACTCGGTGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939935
Expected error %
0.050945
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110L05
Clone
Clone name
hba-110l5
LE_HBa0110L05
C04HBa0110L05
P110L05
Clone type
BAC
Contamination
none
Estimated length
65,472
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found