Clone Read LE_HBa0110L05_T7_35481

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110L05_T7_35481
Primer
T7
ID from Seq. Facility
LE_HBa_110_L05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
753 trimmed for vector and quality, 797 raw
Sequence
>LE_HBa0110L05_T7_35481 (raw untrimmed)
GCTGGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTTAGGACTAAATATGTGTTTGGAAGGTGTTGCATTTTGTGATAGACAAG
GATTGAAAGTTACAGCTTGACACTTTCTTTTCCATATATAAAGGTAAGTCCTGCTATAATTTGATTACCCCCTTGACATGAGAAGGTTGATCTACTGTTT
GAGCCATCTACTTCTAACCAAGAGTTTGGGAGTTCGGTATACCAAAGTAAAAACATAAAAAAAGGATTACTTGCTGTTGCAATCAGTAGTTAATATGTTG
GAACTAGCTGATTCCAGAAGATGGTTGAAAAAGGACGTGCTTGCATGCTTTTGGTATTCTGATTTTATGTGTAATTGTTTCTTTTCCATGTTGTGTTCAT
CATTCTAACTTTATTCTGTACGTGTGTCAGGGTAATTGAGGCGGTTGGGATGAAAGCAAAGGAACATTTGTTGGTATTAATGCCCGTATTATTTGCATGC
TTAAAAGATATGAATTCTATGGTGGCAAAGCAATCAGTTATATCTGGCATGAAAATCTTTTGTGGTGTATTGGAGGAATTATCATCTCAGGTCACACACT
TGTTCATGATTTTGTTCTTTCTGTAGCTTGTTGACTGAGCCCGTATCCAACATAGGCTTGTTTCATTATAATCATGGTTGTGATTCTTTTGAGGGGATCT
TTGGTCACTTTCAGCTCGTATCCCAAAAAAAGTCCCTGTCTCTTCTGTGCAAGGCTTGCGCACTAGGTCACTTTTTTTTTTAATTATGGATGTATGT
>LE_HBa0110L05_T7_35481 (trimmed for quality and cloning vector)
AGCTTATTTAGGACTAAATATGTGTTTGGAAGGTGTTGCATTTTGTGATAGACAAGGATTGAAAGTTACAGCTTGACACTTTCTTTTCCATATATAAAGG
TAAGTCCTGCTATAATTTGATTACCCCCTTGACATGAGAAGGTTGATCTACTGTTTGAGCCATCTACTTCTAACCAAGAGTTTGGGAGTTCGGTATACCA
AAGTAAAAACATAAAAAAAGGATTACTTGCTGTTGCAATCAGTAGTTAATATGTTGGAACTAGCTGATTCCAGAAGATGGTTGAAAAAGGACGTGCTTGC
ATGCTTTTGGTATTCTGATTTTATGTGTAATTGTTTCTTTTCCATGTTGTGTTCATCATTCTAACTTTATTCTGTACGTGTGTCAGGGTAATTGAGGCGG
TTGGGATGAAAGCAAAGGAACATTTGTTGGTATTAATGCCCGTATTATTTGCATGCTTAAAAGATATGAATTCTATGGTGGCAAAGCAATCAGTTATATC
TGGCATGAAAATCTTTTGTGGTGTATTGGAGGAATTATCATCTCAGGTCACACACTTGTTCATGATTTTGTTCTTTCTGTAGCTTGTTGACTGAGCCCGT
ATCCAACATAGGCTTGTTTCATTATAATCATGGTTGTGATTCTTTTGAGGGGATCTTTGGTCACTTTCAGCTCGTATCCCAAAAAAAGTCCCTGTCTCTT
CTGTGCAAGGCTTGCGCACTAGGTCACTTTTTTTTTTAATTATGGATGTATGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.953377
Expected error %
0.517804
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110L05
Clone
Clone name
hba-110l5
LE_HBa0110L05
C04HBa0110L05
P110L05
Clone type
BAC
Contamination
none
Estimated length
65,472
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found