Clone Read LE_HBa0110L19_SP6_35508

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110L19_SP6_35508
Primer
SP6
ID from Seq. Facility
LE_HBa_110_L19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
459 trimmed for vector and quality, 776 raw
Sequence
>LE_HBa0110L19_SP6_35508 (raw untrimmed)
GAGATCATCTTTCCTCCATTAACATTCCCCCTTGCTATGAGTGTCCAACACTGTCTTTGTTATTATCATCCTCCCCCCAATAGAAGTATCCCTTTAGTGA
CTCATCATCTATACGGTGATTTGGGATGCTTCTAATAAACGAGGTGAATCTATCCCAAGAACTACTTACTGACTCACCTGGTAGTGCCACAAAGTTGTTT
ACTCTATCTTTGTAGTTTAGTTTCTTGGAGACCGGATAGTAGTGTGCTAAGAAAACATCCCTTGGTTGATTCCAAGTGAAAATTGAGTTATAAGGGAGCT
CAGTTGAACCATATAGCATCCTCTCCCGTTAGTAAGAGGGGAAACACTCTAAGCCCTATTACATCGAAGTCCAAGTCAGGCCTCCCTACATAGCTTTTAC
ACACTGCCCTTACCTTATCTATATGGGCATGTGGATCCTCAGAAGGTAGCCCTGAAAACAAACCTCTGGCAGTGAGCAATTGCATCAGGCTACTATTTAC
CAAAAAAGTATGGTCTGGTGGTAAAAGAGGCAAGACAAGTGGCCCATCGGAGTCTGCTATGTTGTTATAGCCGCTGTTATATTGCTGGTGCCATGGAGCG
TTATTTTGTCCTCTCTTTTGGTGTTTTCTCTGAACATTCCTGTAACTTTTGACCATTTAACTCTCCCCTGATCTTTTGTTTGTTCCTGTTTTGTCCCATC
TCTCTTTCTTTCCTAGCATTTTTTTTTCTTATTCTTTATTGATTGCCTTTATTTAATTATTGTATGTACATTAGCA
>LE_HBa0110L19_SP6_35508 (trimmed for quality and cloning vector)
TGTCCAACACTGTCTTTGTTATTATCATCCTCCCCCCAATAGAAGTATCCCTTTAGTGACTCATCATCTATACGGTGATTTGGGATGCTTCTAATAAACG
AGGTGAATCTATCCCAAGAACTACTTACTGACTCACCTGGTAGTGCCACAAAGTTGTTTACTCTATCTTTGTAGTTTAGTTTCTTGGAGACCGGATAGTA
GTGTGCTAAGAAAACATCCCTTGGTTGATTCCAAGTGAAAATTGAGTTATAAGGGAGCTCAGTTGAACCATATAGCATCCTCTCCCGTTAGTAAGAGGGG
AAACACTCTAAGCCCTATTACATCGAAGTCCAAGTCAGGCCTCCCTACATAGCTTTTACACACTGCCCTTACCTTATCTATATGGGCATGTGGATCCTCA
GAAGGTAGCCCTGAAAACAAACCTCTGGCAGTGAGCAATTGCATCAGGCTACTATTTAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.978405
Expected error %
0.438524
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 114 E Value 1e-33 Identity 76.10% Align. Length 381bp (83.01%) Frame 1
putative reverse transcriptase [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_474896.1| Score 50 E Value 3e-11 Identity 26.90% Align. Length 447bp (97.39%) Frame 1
OSJNBa0021F22.23 [Oryza sativa (japonica cultivar-group)] emb|CAD40055.3| OSJNBa0085C10.7 [Oryza sativa (japonica cultivar-group)] emb|CAE03729.2| OSJNBa0021F22.23 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110L19
Clone
Clone name
hba-110l19
LE_HBa0110L19
P110L19
Clone type
BAC
Contamination
none
Estimated length
127,036
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found