Clone Read LE_HBa0110L19_T7_35509

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110L19_T7_35509
Primer
T7
ID from Seq. Facility
LE_HBa_110_L19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
718 trimmed for vector and quality, 790 raw
Sequence
>LE_HBa0110L19_T7_35509 (raw untrimmed)
ATAGTTCGGACCCGAGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCCTTCTAGTCTTAAACTTGCCTTTAACCTATACTTATTAAATAAGAG
AAAGTATGGGGTTAACTAAACAATGTACTAAGTGTGGCATATGTAAAAACATGCAAAAAGGGAAGTTTTAGTATAAATAGCACTTTCATGCCAAATAAGT
AAAACCTTCATGACTATAGAATTGAAATAGTATATAGATCATCATTTAGCACATAATGAAATATTTCCATAATATTAGCACAAAGAATCACTTAACAGTA
AGTTCCAAAAAACATTACAATGAATCCCTTTCAAATGTTACAGTGAACTCATTCATACAAAAAACACTGTGAACTCATTTCTTTTGAGGTTTTCCTAACC
AAGTTATCCTAAGACTCATTAAGGTAAAACATGAAGGAACCGTCCAACACCCCCTTCAATACACACCTAAGGGATCTTTAAGACTACCAACCATAGGCTT
ACCTCGCACGGGAAACAAGTCCACACTCTAAACTAGACATTTGAAGAACATTCATACATAAAGGACTTCATATAAGTGCCCTGCTCCAACGGNACTTGTA
TGTTACACTAATTGCAATGTGATAGTATTATCCCATACTACTACTCCCACTTAGTGCCCCTTAAGGATTCCTTTGGATCAAGAACACTACATTCGTCCTT
CATAACTTCATTATGTAAAACCTAATTTTAACATGCTTTCTTATCATTAAAACCTTAAATAATATGAAAGATCCCCAATTGGCCTAGGGA
>LE_HBa0110L19_T7_35509 (trimmed for quality and cloning vector)
AGCTTGCCTTCTAGTCTTAAACTTGCCTTTAACCTATACTTATTAAATAAGAGAAAGTATGGGGTTAACTAAACAATGTACTAAGTGTGGCATATGTAAA
AACATGCAAAAAGGGAAGTTTTAGTATAAATAGCACTTTCATGCCAAATAAGTAAAACCTTCATGACTATAGAATTGAAATAGTATATAGATCATCATTT
AGCACATAATGAAATATTTCCATAATATTAGCACAAAGAATCACTTAACAGTAAGTTCCAAAAAACATTACAATGAATCCCTTTCAAATGTTACAGTGAA
CTCATTCATACAAAAAACACTGTGAACTCATTTCTTTTGAGGTTTTCCTAACCAAGTTATCCTAAGACTCATTAAGGTAAAACATGAAGGAACCGTCCAA
CACCCCCTTCAATACACACCTAAGGGATCTTTAAGACTACCAACCATAGGCTTACCTCGCACGGGAAACAAGTCCACACTCTAAACTAGACATTTGAAGA
ACATTCATACATAAAGGACTTCATATAAGTGCCCTGCTCCAACGGNACTTGTATGTTACACTAATTGCAATGTGATAGTATTATCCCATACTACTACTCC
CACTTAGTGCCCCTTAAGGATTCCTTTGGATCAAGAACACTACATTCGTCCTTCATAACTTCATTATGTAAAACCTAATTTTAACATGCTTTCTTATCAT
TAAAACCTTAAATAATAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.944628
Expected error %
1.37246
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110L19
Clone
Clone name
hba-110l19
LE_HBa0110L19
P110L19
Clone type
BAC
Contamination
none
Estimated length
127,036
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found