Clone Read LE_HBa0008K01_SP6_3552

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008K01_SP6_3552
Primer
SP6
ID from Seq. Facility
LE_HBa_008_K01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
681 trimmed for vector and quality, 947 raw
Genbank Accession
Sequence
>LE_HBa0008K01_SP6_3552 (raw untrimmed)
CCGGGGCACGCATATGTAANTACTTGTATGGACTGAAGCAGCACCAAGGCAATGGAACTTAAAACTAACAGAGGCTTTAGTGGATATAGGATTTTTACAA
TCTCATTATGATTACTCACTTTTTACTAAGAACATAGGTAAAGATCTTCTAGTCATCTTGGTTTATGTTGATGATCTCCTGGTTACTGGGAGCAGTTTGC
ATCATATACAACAAATAAGGAAGGAACTACAACAAAGGTTCAGAATGAAAGATCTTGGTGAGCTTAAATATTTTCTTGGAATTGAATTCTCCAGATCTAA
AGAAGGTATACTGATGAATCAAAGGAAGTATGCTTTAGGACTTGTGTCTGAGTTGGGATTAGCAGGTTGTAAGCCTTCTTCTACACCCTTGGAGTTTAAT
CACAAGCTAACTTCTACTGTGTTTGATGAAGTTATTGAGAAAAATACTAATGCAGAAGACTTAATTCTTGATGAGTTTGGAAAATATCAGAGGCTAATAG
GAAAGTTACTATACTTAACCATGACTAGACCTGATATAGCTTTTGTTGTACAGGTTCTTAGCCAATATATGCACTCTCCTAAATCATCTCATATGGAAGC
TGCACTCAGAGTAGTGAGGTATATAAAAGGTACTGCAGGCCTTGGATTGTTTATGCCAAGTAACAAAAACAATGAAATGGTAGCTTATTGTGACTCTGAC
CGGGGAGCTTGTGTAGAAACAAGAAGGTCAGTTACTGGTTATATGATTAAACTAGGAGGAGCACTGGTGTCTTGGAATTAAAAAAACAAAACACATAATC
AAGGAGCTCTGCAAAAGCTGAATTCAGGAGTATGGCCACTCAAGTTGCTGAGAAAGTCTGGTTAAAAGGTTTGTTCAAAAGTTAGGAATGAACATAAAGT
CGCCGTGAAAGTATTTGGGGAAACAAAGCTGGTATCTAAAAGACACC
>LE_HBa0008K01_SP6_3552 (trimmed for quality and cloning vector)
AGCACCAAGGCAATGGAACTTAAAACTAACAGAGGCTTTAGTGGATATAGGATTTTTACAATCTCATTATGATTACTCACTTTTTACTAAGAACATAGGT
AAAGATCTTCTAGTCATCTTGGTTTATGTTGATGATCTCCTGGTTACTGGGAGCAGTTTGCATCATATACAACAAATAAGGAAGGAACTACAACAAAGGT
TCAGAATGAAAGATCTTGGTGAGCTTAAATATTTTCTTGGAATTGAATTCTCCAGATCTAAAGAAGGTATACTGATGAATCAAAGGAAGTATGCTTTAGG
ACTTGTGTCTGAGTTGGGATTAGCAGGTTGTAAGCCTTCTTCTACACCCTTGGAGTTTAATCACAAGCTAACTTCTACTGTGTTTGATGAAGTTATTGAG
AAAAATACTAATGCAGAAGACTTAATTCTTGATGAGTTTGGAAAATATCAGAGGCTAATAGGAAAGTTACTATACTTAACCATGACTAGACCTGATATAG
CTTTTGTTGTACAGGTTCTTAGCCAATATATGCACTCTCCTAAATCATCTCATATGGAAGCTGCACTCAGAGTAGTGAGGTATATAAAAGGTACTGCAGG
CCTTGGATTGTTTATGCCAAGTAACAAAAACAATGAAATGGTAGCTTATTGTGACTCTGACCGGGGAGCTTGTGTAGAAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952782
Expected error %
0.16926
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 154 E Value 6e-38 Identity 11.90% Align. Length 671bp (98.53%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 228 E Value 1e-58 Identity 17.20% Align. Length 674bp (98.97%) Frame 3
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAR24647.1| Score 196 E Value 6e-49 Identity 15.50% Align. Length 671bp (98.53%) Frame 3
At2g23330 [Arabidopsis thaliana] gb|AAM98191.1| unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008K01
Clone
Clone name
hba-8k1
LE_HBa0008K01
P008K01
Clone type
BAC
Contamination
none
Estimated length
106,529
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found