Clone Read LE_HBa0008K01_T7_3553

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008K01_T7_3553
Primer
T7
ID from Seq. Facility
LE_HBa_008_K01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
763 trimmed for vector and quality, 941 raw
Genbank Accession
Sequence
>LE_HBa0008K01_T7_3553 (raw untrimmed)
TAACCTGGTCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACCGCAAGGTGACAAAGCATCTGAGGATCTAAATAAGTGACAAACTAC
TCGAATATGCCATTATAAAAAAGATACCTCCTCTTCTGAAGCCAAGCTTGCTGCTGAGCTTGTTGACGAGAAAGATTCCGGTAATAGAATTGGAACTGCA
AATAAAGCACTAGTGTTAGTAAACAATCACAACACAATAAAAGGAAAGATTGACCCAGGAAGAGGAAAGACAAACCTTTTGCTGCTCCATCGACAAGTCA
TCCATGCATTCAATCAAAAATTCCACATTCCTCTCCAAATATGGATTGGTTGATAATTGTAAGCGTTCATAATCACACTGACAAAAGGAAGAAAATTGTC
AGTATTACAGATTGGCCACATATATAAATATTCAGTATTCTGCCAAACTTAAGTTACATTACCTGAGTTACAGGTGTATCGGGTTCCAATTCAGTCATAA
AGGCACTAATGAGTGCAGAATTTGAAACTTTTATCTGTAAAAAAAAGACGAAATTAACTTCTGCAGTAAAGTTGAAGACTTCTGCTGAATTACTAACCTA
TGAACAATGTACCTATACTAACACCAGGCAGGTAGAATCACTATATGATGATGGTATTACTCAAAATAATGTTCAAACCAAGAAAATGTGTGGCAGCCAT
GCACGTATCAAATTCTTAAAGGAGGAAGAACTATTTTCAAGAACACAACGAAGGAAAAAAGAAAAAGGGTCCCCTAGGGAAAAAGGCTAATGTATTCAAA
CTATATTTTTATTTTCTCAAACACCGATCTTCCAACAAATACACTGGCTCGGACTTGCGAATGGTAAAGGTTTGAAACAAAAATGTCCTTGAAAAAAAAT
TTCTTTGATTATGCAGTGCCAAAAAAAAAAAAATAAAATGG
>LE_HBa0008K01_T7_3553 (trimmed for quality and cloning vector)
AGCTTAACCGCAAGGTGACAAAGCATCTGAGGATCTAAATAAGTGACAAACTACTCGAATATGCCATTATAAAAAAGATACCTCCTCTTCTGAAGCCAAG
CTTGCTGCTGAGCTTGTTGACGAGAAAGATTCCGGTAATAGAATTGGAACTGCAAATAAAGCACTAGTGTTAGTAAACAATCACAACACAATAAAAGGAA
AGATTGACCCAGGAAGAGGAAAGACAAACCTTTTGCTGCTCCATCGACAAGTCATCCATGCATTCAATCAAAAATTCCACATTCCTCTCCAAATATGGAT
TGGTTGATAATTGTAAGCGTTCATAATCACACTGACAAAAGGAAGAAAATTGTCAGTATTACAGATTGGCCACATATATAAATATTCAGTATTCTGCCAA
ACTTAAGTTACATTACCTGAGTTACAGGTGTATCGGGTTCCAATTCAGTCATAAAGGCACTAATGAGTGCAGAATTTGAAACTTTTATCTGTAAAAAAAA
GACGAAATTAACTTCTGCAGTAAAGTTGAAGACTTCTGCTGAATTACTAACCTATGAACAATGTACCTATACTAACACCAGGCAGGTAGAATCACTATAT
GATGATGGTATTACTCAAAATAATGTTCAAACCAAGAAAATGTGTGGCAGCCATGCACGTATCAAATTCTTAAAGGAGGAAGAACTATTTTCAAGAACAC
AACGAAGGAAAAAAGAAAAAGGGTCCCCTAGGGAAAAAGGCTAATGTATTCAAACTATATTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.952459
Expected error %
0.757691
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g10840.1 Score 58 E Value 3e-21 Identity 74.00% Align. Length 413bp (54.13%) Frame 1
68414.m01246 eukaryotic translation initiation factor 3 subunit 3 / eIF-3 gamma / eIF3h (TIF3H1) identical to SP|Q9C5Z2 Eukaryotic translation initiation factor 3 subunit 3 (eIF-3 gamma) (eIF3 p38 subunit) (eIF3h) {Arabidopsis thaliana}; contains Pfam profile PF01398: Mov34/MPN/PAD-1 family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g10840.2 Score 58 E Value 3e-21 Identity 74.00% Align. Length 413bp (54.13%) Frame 1
68414.m01245 eukaryotic translation initiation factor 3 subunit 3 / eIF-3 gamma / eIF3h (TIF3H1) identical to SP|Q9C5Z2 Eukaryotic translation initiation factor 3 subunit 3 (eIF-3 gamma) (eIF3 p38 subunit) (eIF3h) {Arabidopsis thaliana}; contains Pfam profile PF01398: Mov34/MPN/PAD-1 family
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE04596.2| Score 59 E Value 2e-19 Identity 70.00% Align. Length 413bp (54.13%) Frame 1
OSJNBb0006N15.13 [Oryza sativa (japonica cultivar-group)] ref|XP_472198.1| OSJNBb0006N15.13 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN31904.1| Score 58 E Value 2e-19 Identity 74.00% Align. Length 413bp (54.13%) Frame 1
putative translation initiation factor [Arabidopsis thaliana] gb|AAM64888.1| putative translation initiation factor [Arabidopsis thaliana] gb|AAM10108.1| unknown protein [Arabidopsis thaliana] ref|NP_563880.1| eukaryotic translation initiation factor 3 subunit 3 / eIF-3 gamma / eIF3h (TIF3H1) [Arabidopsis thaliana] gb|AAK96832.1| Unknown protein [Arabidopsis thaliana] gb|AAD31329.1| Similar to gb|U54559 eIF3-p40 subunit from Homo sapiens and is a member of the PF|01398 Mov34 family. ESTs gb|N96623 and gb|N07519 come from this gene. [Arabidopsis thaliana] pir||B86242 hypothetical protein [imported] - Arabidopsis thaliana sp|Q9C5Z2|IF33_ARATH Eukaryotic translation initiation factor 3 subunit 3 (eIF-3 gamma) (eIF3 p38 subunit) (eIF3h)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008K01
Clone
Clone name
hba-8k1
LE_HBa0008K01
P008K01
Clone type
BAC
Contamination
none
Estimated length
106,529
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found