Clone Read LE_HBa0110P10_SP6_35682

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110P10_SP6_35682
Primer
SP6
ID from Seq. Facility
LE_HBa_110_P10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
605 trimmed for vector and quality, 805 raw
Sequence
>LE_HBa0110P10_SP6_35682 (raw untrimmed)
GTTGCGTTTCCTTCTTTTGAAGCGCTCTAGTACACGTCCAATGTATTTCTTATGGGACAAATAAATCTTTCTTTCATCCCTGAGAAGAGTAATTCTCATG
CCCAAAATTTATTTTGCATGACCCAAGTCTTTCATAGAAAAAGACTTAAATAACTCTTTTTTCAGCTCGTCAAACTTAGAAGTATTCTTTCCCACCATCA
ACATATCATCCACATACAGCAAAAGGATGATAAAACCATTGTCAGAAATTTTTTGTACAAATACACAATGATCTGAAGAAATCTTCTTATAGCCTTGCTC
CCCTATAACAAATTCAAACTTCTTGTACCACTGTCTAGGAGCTTGTTTTAATCCATATAGACTCTTCTGACATTGCATACAAAATATTCTTTACCTTCTA
CGTTGAAGCCCTCATGTTGTTCCATATAAATCTCTTCATCTAGGTCACCGAGGAAAGTCGTCTTCACATCCATCTGCTCAATCTCTAAGCTAAGACTAGC
AGCCAAACCTAGAACTATACAAATCGAGTACATTTTCACAACAAGTGAAAATATTTCGTTAAAGTCAATACCCTTTCTTTGACCAAATCCCTTAACAACC
AATCTAGCTTTGTATCTGTGTTTCAAGTTGTGTCTTCAAGTTTAACTTTGAACACCCACTTGTTTTTCAAAGCTCTCAGGCCCTTAGGGCAATTACCAAT
TCATAAGTGTGGTTCTCATGCAGAGACTTTATCCCCTTTTGCTTGTACTTTCAAACATTTGATCCTTTGGGTTATCTTTCTTTTGTCTCCTTATTACTTT
CTGGT
>LE_HBa0110P10_SP6_35682 (trimmed for quality and cloning vector)
GTACACGTCCAATGTATTTCTTATGGGACAAATAAATCTTTCTTTCATCCCTGAGAAGAGTAATTCTCATGCCCAAAATTTATTTTGCATGACCCAAGTC
TTTCATAGAAAAAGACTTAAATAACTCTTTTTTCAGCTCGTCAAACTTAGAAGTATTCTTTCCCACCATCAACATATCATCCACATACAGCAAAAGGATG
ATAAAACCATTGTCAGAAATTTTTTGTACAAATACACAATGATCTGAAGAAATCTTCTTATAGCCTTGCTCCCCTATAACAAATTCAAACTTCTTGTACC
ACTGTCTAGGAGCTTGTTTTAATCCATATAGACTCTTCTGACATTGCATACAAAATATTCTTTACCTTCTACGTTGAAGCCCTCATGTTGTTCCATATAA
ATCTCTTCATCTAGGTCACCGAGGAAAGTCGTCTTCACATCCATCTGCTCAATCTCTAAGCTAAGACTAGCAGCCAAACCTAGAACTATACAAATCGAGT
ACATTTTCACAACAAGTGAAAATATTTCGTTAAAGTCAATACCCTTTCTTTGACCAAATCCCTTAACAACCAATCTAGCTTTGTATCTGTGTTTCAAGTT
GTGTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939662
Expected error %
0.0966779
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 80 E Value 2e-31 Identity 40.40% Align. Length 574bp (94.88%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 155 E Value 5e-67 Identity 63.60% Align. Length 586bp (96.86%) Frame 3
hypothetical retrotransposon [Ipomoea batatas]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA32025.1| Score 130 E Value 2e-58 Identity 59.80% Align. Length 586bp (96.86%) Frame 3
unnamed protein product [Nicotiana tabacum] sp|P10978|POLX_TOBAC Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Contains: Protease ; Reverse transcriptase ; Endonuclease]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110P10
Clone
Clone name
hba-110p10
LE_HBa0110P10
P110P10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found