Clone Read LE_HBa0110P10_T7_35683

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0110P10_T7_35683
Primer
T7
ID from Seq. Facility
LE_HBa_110_P10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
655 trimmed for vector and quality, 785 raw
Sequence
>LE_HBa0110P10_T7_35683 (raw untrimmed)
CTCGAGACCGGGGGGATTCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCCAAAGAAACAGATTAAAAGACTCAAGTTGATGAGTCAAAAGATACAAAT
TTTGAAGAACTTGTTGTCAATGAAGTATACACAATTACAAATGAAAAGGACAAAAGGTAGATGCAGAAATCGAAACGTCTTGAAGAGTAAGCAAATATAA
TTATATATGCATTTGTAGCTAGATAGAAAAGATAAAGTATCTCGAGACCTCCTCGTATGTTGAAGCAACTTTTTGCAAGGATGTTGCAAAGTGACAATTA
GCCATGATTGAGAAGATGGTGTCTCTTCACAAATATGAGACATGTGTCTTAGTTGAAAGACCAAAGGGGAAGAAAACAGTTGGATGCAAATGAGTCTACA
ACTCGAAAAAGGTATTTCAAAATTAGAAAATGTAAGGTTCAAGGCGGCGAGATTGGTTTCATAGGTTTTCAGTTAGAAGGAGGGAATTGACTACAATGAG
ATTTTCTCTCCGGTCGTAAAACATAGTTCAATTGATATAAGCATTGGTTGCACAATTCTATTTGGAGCTTCAACAACTTGATGTCAAAACTGTTTACTAA
CTTGGTGATCTAAAAAAAGACAATCTATAAAGGTATCCTAATTGGAGAAAAAATAAGATTATGTATGCCAACTAAAAAAGTCATCGCATGCCTTGGAAAA
TATTCCCTAAAATTGGTACAAAAGATTTGAGGCTTTCTTGACTACATTTAATTTTTAAGGAGGGTATTTGGAAGTTTTGTGTATC
>LE_HBa0110P10_T7_35683 (trimmed for quality and cloning vector)
AGCTTGCCAAAGAAACAGATTAAAAGACTCAAGTTGATGAGTCAAAAGATACAAATTTTGAAGAACTTGTTGTCAATGAAGTATACACAATTACAAATGA
AAAGGACAAAAGGTAGATGCAGAAATCGAAACGTCTTGAAGAGTAAGCAAATATAATTATATATGCATTTGTAGCTAGATAGAAAAGATAAAGTATCTCG
AGACCTCCTCGTATGTTGAAGCAACTTTTTGCAAGGATGTTGCAAAGTGACAATTAGCCATGATTGAGAAGATGGTGTCTCTTCACAAATATGAGACATG
TGTCTTAGTTGAAAGACCAAAGGGGAAGAAAACAGTTGGATGCAAATGAGTCTACAACTCGAAAAAGGTATTTCAAAATTAGAAAATGTAAGGTTCAAGG
CGGCGAGATTGGTTTCATAGGTTTTCAGTTAGAAGGAGGGAATTGACTACAATGAGATTTTCTCTCCGGTCGTAAAACATAGTTCAATTGATATAAGCAT
TGGTTGCACAATTCTATTTGGAGCTTCAACAACTTGATGTCAAAACTGTTTACTAACTTGGTGATCTAAAAAAAGACAATCTATAAAGGTATCCTAATTG
GAGAAAAAATAAGATTATGTATGCCAACTAAAAAAGTCATCGCATGCCTTGGAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.932752
Expected error %
0.545072
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0110P10
Clone
Clone name
hba-110p10
LE_HBa0110P10
P110P10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found