Clone Read LE_HBa0201D24_SP6_359986

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0201D24_SP6_359986
Primer
SP6
ID from Seq. Facility
LE_HBa_201_D24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
40 trimmed for vector and quality, 1120 raw
Sequence
>LE_HBa0201D24_SP6_359986 (raw untrimmed)
TGGGTGATACTACAATAATCCGGTTGGTGGTGCAGGAACAATCAAGAAGAGGGCCCCTTATCATGATGAGACTTTTGCACCTGTTTGCTAGAATGGAACT
TTATTAGAATTTTAAATAG
CTTTTCTGCATTTATGGGGTTCAAGCTGTACAAATGGATGTGAAAGTGCATTTCCAATGGAGATTCCAAAAAAGAAGTGGT
GTTTGGAAACAAATCCTCTCACTAAGAAGACCCATCACAACTCTATAGGATGTCAACTACCGATAATGGTTACCATCATTTCCCTACATTTGGAATAAAA
GGGACCTGCATCGGTTCTGAAACAGGGCCCCCTTCTAAAACTGTTAAAGGTATCAAGTTCCAATTCCCTCCTTTCTTTTCTGCTTCAAAAAAATGGGTTT
CCCACAAATAAGGGCCAAAAAACCAAAAAAACTTTTGTTCTCACCCAAACTCTAAAGAGGAAAAACCCCAGCATTTTGTACTTTTAATTCCTTTTCCCAA
ATGTAAATGGGGGGGGAAAAAACCCCAATTTTGGCTTTGGAACCTCCCCTCTAAAAAAAACAATTTTTCGTGCTCGTAAAAAAAATTCCCTCCCACACAA
AAATTCTTTGGGAAATCCGCCCTTTTTCTCCACAAAACACATAACACAGAGGTGGGGACAATTTATTATTTCCCCAATCTCCCCTGGGTGTCTTCTTCCA
TAATACCTACTCCTCACTCACCTTCAAATAGTGGGCAAATTCTCATTTATTTTGTCCCCCCCCCCCAACCTAATATTTAATTTGTTATTCTCTTTCCCCA
AATAAAACACACCTAATTAATATTCTTATTCCTAACTATGCCCCTCGTAACACACTAATAAAACTATTCTTCATTGAGAGACACAACAACTCCGTCATGT
ATACACACTAGCTTCTCTCTTATATTTCCACATCCCCACTCCCTCGTGGAATCCTCCTAACCACTATTCCTCAACACGCTCAACACAACATTCTGCCTCT
CTACCTAGTTAAATCTATACCCCACTCGCCACCAAACTTGACCCTTCCAAAAACACTCTCTACCTCAACCCTATTTAAAAGGTCGTTTCATCCCCTTTCA
AGAGTACTTCTTTTGTTTAG
>LE_HBa0201D24_SP6_359986 (trimmed for quality and cloning vector)
CTTTTCTGCATTTATGGGGTTCAAGCTGTACAAATGGATG

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for contaminants
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.810362
Expected error %
1.31374
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0201D24
Clone
Clone name
hba-201d24
LE_HBa0201D24
P201D24
Clone type
BAC
Contamination
none
Estimated length
126,391
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found