Clone Read LE_HBa0201D24_T7_359987

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0201D24_T7_359987
Primer
T7
ID from Seq. Facility
LE_HBa_201_D24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
735 trimmed for vector and quality, 781 raw
Sequence
>LE_HBa0201D24_T7_359987 (raw untrimmed)
CTCTAGAGTCGCCTGCAGGCATGCAAGCTTAGTCCAAGATTCATTGAGCCATCCCTTACCGTTTGGAGGATAGGAAAAGTGGCTTATGAGTAACACTTTC
CAGGGGGGTTAGAATTGGTTAATCAGATATTTCATATATCAATGCTACAGAAGTGCATAGGAGACATTCTACTGTTGTCCTTGTTGAGGATTTTCAGATC
ACAAATGAGTTGTCCTATGAGGAAACTCAGTTGCAATATTAGATTGACAGGTTCAAAGGTTGAGGATCAAAGATGTGTCTTTTATTAAAGTATAGTGGAG
AAGCAAAAATAAAGAAGAGGTGATGTGGAAAGCCGAGGATAGCATGAGATACATATATCCTTAAAAATATCAATCTTGATTAGCACAGTGAGATAGGATA
TCCATTTAGTTTTTTTTGTGGCTGATTATTGTTGTTGTAGTAGTATTTTGCTCATACTATTATTCCGAAGCTGTGGGGCTTATCTATTTGTATCGTTGTA
ACATCTGTTAACTTGAAAAAGATAGAAATAAGCTAAGAAACTAAAATTTATCACTTTTTGAAAGAAAAAGAAAAATCAGGAAAACTTCCTAAGTTAAGAA
ATTTAGTTTTTTATTATTTTCAAACGATCATAACTTATAGCTCAGGATGAGTTGGAGTAAAAACTTGATATGGTTGGAAAGATCTTAGGGAGATGTTTCC
AAATCCACCTAGTTTGAGAATTTCCTATATCAGATAAGGGAGATATGCCTATCGAAAGTTGGGTTGTTGGATTGTAAGGTT
>LE_HBa0201D24_T7_359987 (trimmed for quality and cloning vector)
CCTGCAGGCATGCAAGCTTAGTCCAAGATTCATTGAGCCATCCCTTACCGTTTGGAGGATAGGAAAAGTGGCTTATGAGTAACACTTTCCAGGGGGGTTA
GAATTGGTTAATCAGATATTTCATATATCAATGCTACAGAAGTGCATAGGAGACATTCTACTGTTGTCCTTGTTGAGGATTTTCAGATCACAAATGAGTT
GTCCTATGAGGAAACTCAGTTGCAATATTAGATTGACAGGTTCAAAGGTTGAGGATCAAAGATGTGTCTTTTATTAAAGTATAGTGGAGAAGCAAAAATA
AAGAAGAGGTGATGTGGAAAGCCGAGGATAGCATGAGATACATATATCCTTAAAAATATCAATCTTGATTAGCACAGTGAGATAGGATATCCATTTAGTT
TTTTTTGTGGCTGATTATTGTTGTTGTAGTAGTATTTTGCTCATACTATTATTCCGAAGCTGTGGGGCTTATCTATTTGTATCGTTGTAACATCTGTTAA
CTTGAAAAAGATAGAAATAAGCTAAGAAACTAAAATTTATCACTTTTTGAAAGAAAAAGAAAAATCAGGAAAACTTCCTAAGTTAAGAAATTTAGTTTTT
TATTATTTTCAAACGATCATAACTTATAGCTCAGGATGAGTTGGAGTAAAAACTTGATATGGTTGGAAAGATCTTAGGGAGATGTTTCCAAATCCACCTA
GTTTGAGAATTTCCTATATCAGATAAGGGAGATAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940746
Expected error %
0.59288
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0201D24
Clone
Clone name
hba-201d24
LE_HBa0201D24
P201D24
Clone type
BAC
Contamination
none
Estimated length
126,391
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found