Clone Read LE_HBa0201O12_T7_360491

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0201O12_T7_360491
Primer
T7
ID from Seq. Facility
LE_HBa_201_O12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
808 trimmed for vector and quality, 857 raw
Sequence
>LE_HBa0201O12_T7_360491 (raw untrimmed)
NNGGTACTGACGGGGATCTCTGAGTGACCTGCAGGCATGCAAGCTTCCTAAAGGGTGCTAGTTCAATGCAATTAAAGATTAAAAAAAGAATATAACTCCA
TTTGCTTAATCCCTTTTTAATTAATTTACAAATTAAAATTGATTATGCTTTAAAAATAAGATGGGTGAATAAAAAACATAGCTAACTTCATATTTAAATA
GTTGGTGTATAAAAGACACATATTATATATTATTAGTCTGAAAGTAAATCAATTTGTGTTCGATACCAACTAGTGAAATTATAGGGAAAAAACATTAAAT
GTTATTTGCACGTCATAATAATAGTAAGACTCAAGGTTTGGACTCTTACAAATAAATTTAAGTGAAGTCAGTCAACTTTCTTCTACATCTATTACAACAT
AAATTGTCTTAAACAAGTCTAAAAACTTTATAGTGTTGTAATTTGATTATTATTTTCAGTTAAATTCATACAATATGTTTTTTCTATGATTAAACTAGAT
GACTTTACAAGTTTTGTAATCAACCTCTAGATTCTACATCTTATTTCTTATGTGAAGATATGCATAAATTTTTTAATTTTTAATTGTTTCTAGTTAATTT
GTATTTTATAAAAAATAATTGTTATATAATAAAAATTTACCTGTTTACTCTATTTATTTTCTTATTTAAAAAAATGCAATGAAATAGTAATTTCTATGTT
ACTTATTTTGTGAACATATACTAGAGGCTCAAAGATAGATATTATTTAGGCCAATTCCAACATATTTTTGGTGGAACTTTTCATAATTTTTTTCCCTATA
ATATCTAAAGAATATAAAATGATCTCAAGAAAATGAAGAAAAATATTTAAACAGTCA
>LE_HBa0201O12_T7_360491 (trimmed for quality and cloning vector)
CCTGCAGGCATGCAAGCTTCCTAAAGGGTGCTAGTTCAATGCAATTAAAGATTAAAAAAAGAATATAACTCCATTTGCTTAATCCCTTTTTAATTAATTT
ACAAATTAAAATTGATTATGCTTTAAAAATAAGATGGGTGAATAAAAAACATAGCTAACTTCATATTTAAATAGTTGGTGTATAAAAGACACATATTATA
TATTATTAGTCTGAAAGTAAATCAATTTGTGTTCGATACCAACTAGTGAAATTATAGGGAAAAAACATTAAATGTTATTTGCACGTCATAATAATAGTAA
GACTCAAGGTTTGGACTCTTACAAATAAATTTAAGTGAAGTCAGTCAACTTTCTTCTACATCTATTACAACATAAATTGTCTTAAACAAGTCTAAAAACT
TTATAGTGTTGTAATTTGATTATTATTTTCAGTTAAATTCATACAATATGTTTTTTCTATGATTAAACTAGATGACTTTACAAGTTTTGTAATCAACCTC
TAGATTCTACATCTTATTTCTTATGTGAAGATATGCATAAATTTTTTAATTTTTAATTGTTTCTAGTTAATTTGTATTTTATAAAAAATAATTGTTATAT
AATAAAAATTTACCTGTTTACTCTATTTATTTTCTTATTTAAAAAAATGCAATGAAATAGTAATTTCTATGTTACTTATTTTGTGAACATATACTAGAGG
CTCAAAGATAGATATTATTTAGGCCAATTCCAACATATTTTTGGTGGAACTTTTCATAATTTTTTTCCCTATAATATCTAAAGAATATAAAATGATCTCA
AGAAAATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.884841
Expected error %
0.547511
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0201O12
Clone
Clone name
hba-201o12
LE_HBa0201O12
C12HBa0201O12
P201O12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found