Clone Read LE_HBa0201O22_SP6_360510

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0201O22_SP6_360510
Primer
SP6
ID from Seq. Facility
LE_HBa_201_O22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
761 trimmed for vector and quality, 863 raw
Sequence
>LE_HBa0201O22_SP6_360510 (raw untrimmed)
TTCGGGNNCCAATTATTTGTTCAACAGCTCTGTGCCTTTTGACGAAAAGCCATTGAATCAGCGGATAAAGCTCTGTTGACTCTTCTTCAGAAATTGACTG
AGATGAAGAGTTTGTATAAGGATTTCAGGAGAAACCCAAGTTGTAATATTGATTTGCTTATGGGGTCAGAGCTGGAATTTCAGGTACAGGAGCATCAGAG
CAAGCTCAGAGTTTTGGAGACTATGGTAAATCAATTACTGTCTTATATGGAGTCTAAAGATGAAGAAGTTTCAATTTTGAGGAAGAAATTGGATAAAATT
CAAGATTCTAATTTGAGTTTGTCAAAAAAATTAGGGGTAGAAAATGAAAAATCGAACAATAGTACTACAGAGGTATTGTGTACAGTTCGTGTTTTTGAAT
CTATGCTACGCGATTCGATTAAGTCAGCTAATAAATTTTCTAAGTTATTGATGGAATTAATGAAAAGGGCAGGTTGGGATTTGGAAAAAGCAGCAAATTC
TGTGTATTCTGATGTTAATTATGCAGGAAAAGAACACCATAAATATGCATTTCTATCATATATTTGTTTAGGCATGTTTAAAGGTTTTGATCTGGAAGAC
TTTGGTCTGTGTGATGAAGAAATATTGTCTGATGGATCAGTATCTGATGAGAACGACCATTTGAAACAATTACTTGAGCATGTTTCATGTAATCCAATGG
AGACTTTGAGTAAGAATCCTAGTTGTGCATTTTCAAGATATTGTGATAAGAAGTATGAGCAGATAATTCATCATACAATAGAATCATCCATTTTCAGGNA
TTTGGATGGGGAAGAAGTCATAGTTGATTCGTGGAAGTCGTTTAAATGTGTTTATGAGTTGTN
>LE_HBa0201O22_SP6_360510 (trimmed for quality and cloning vector)
TGCCTTTTGACGAAAAGCCATTGAATCAGCGGATAAAGCTCTGTTGACTCTTCTTCAGAAATTGACTGAGATGAAGAGTTTGTATAAGGATTTCAGGAGA
AACCCAAGTTGTAATATTGATTTGCTTATGGGGTCAGAGCTGGAATTTCAGGTACAGGAGCATCAGAGCAAGCTCAGAGTTTTGGAGACTATGGTAAATC
AATTACTGTCTTATATGGAGTCTAAAGATGAAGAAGTTTCAATTTTGAGGAAGAAATTGGATAAAATTCAAGATTCTAATTTGAGTTTGTCAAAAAAATT
AGGGGTAGAAAATGAAAAATCGAACAATAGTACTACAGAGGTATTGTGTACAGTTCGTGTTTTTGAATCTATGCTACGCGATTCGATTAAGTCAGCTAAT
AAATTTTCTAAGTTATTGATGGAATTAATGAAAAGGGCAGGTTGGGATTTGGAAAAAGCAGCAAATTCTGTGTATTCTGATGTTAATTATGCAGGAAAAG
AACACCATAAATATGCATTTCTATCATATATTTGTTTAGGCATGTTTAAAGGTTTTGATCTGGAAGACTTTGGTCTGTGTGATGAAGAAATATTGTCTGA
TGGATCAGTATCTGATGAGAACGACCATTTGAAACAATTACTTGAGCATGTTTCATGTAATCCAATGGAGACTTTGAGTAAGAATCCTAGTTGTGCATTT
TCAAGATATTGTGATAAGAAGTATGAGCAGATAATTCATCATACAATAGAATCATCCATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.936659
Expected error %
0.232636
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0201O22
Clone
Clone name
hba-201o22
LE_HBa0201O22
C05HBa0201O22
P201O22
Clone type
BAC
Contamination
none
Estimated length
100,103
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found