Clone Read LE_HBa0111K24_T7_36239

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0111K24_T7_36239
Primer
T7
ID from Seq. Facility
LE_HBa_111_K24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
329 trimmed for vector and quality, 724 raw
Genbank Accession
Sequence
>LE_HBa0111K24_T7_36239 (raw untrimmed)
TGGTCATCTTAATCATTAATCCCTTCATTCATCAAGATACTCCCACATAAATCAAATTCCAAGCGAACATCCTGGAGCATGCTTGACATTATTAAGAACT
AGTTTGGAACCGTTACTTTCCAAACAAACTGTCCCAATGCCAATAACTTCAACTTCATGATTATTGCCCATTTTCAACGTTCCAAAATTACCTGGAGTAT
AAGAAGAAAATAATTCCTTCTTTGGCGTGACATGAGAAGTATCACCAGAATCCACAAACCAGCTAAGACTCATCACGAACAAGATCTAATGGCATTTTCA
TCACAAGAAACAAGAAGATCATTATTAGCATCAACAGCAACACGATTTTCATTATCGCCTTCTCTCTTTTGTTGTCTCATATCTCTCTTGTGCTTGTAAC
AATATTTCATGATATGCTCTTTCTTGTGGCAATATTCACTTGTAATATCTCTGTATCTAGACTTTGTATTGCTTCTCTCTTTTATCTCTTTCATTCTGAC
CTCCTGAATTTGTTTCCCCCCTATCTTTCTTAACCAAAACTTCCACATTGTGTTATTTTAAATTTATAGACCTTTGCCAACCTTCTTTTCCCATTCTACA
TCTCATCTACCCCCTCCTATTTTGTTACCCATCTTACTTCCCCCCCTACCTAATCAAATTCTACTCCCCAATATACCCCTAATTAGTCTTCCTAAAATTT
TTTTCTAATCTCTTCTAAATCTCT
>LE_HBa0111K24_T7_36239 (trimmed for quality and cloning vector)
CCACATAAATCAAATTCCAAGCGAACATCCTGGAGCATGCTTGACATTATTAAGAACTAGTTTGGAACCGTTACTTTCCAAACAAACTGTCCCAATGCCA
ATAACTTCAACTTCATGATTATTGCCCATTTTCAACGTTCCAAAATTACCTGGAGTATAAGAAGAAAATAATTCCTTCTTTGGCGTGACATGAGAAGTAT
CACCAGAATCCACAAACCAGCTAAGACTCATCACGAACAAGATCTAATGGCATTTTCATCACAAGAAACAAGAAGATCATTATTAGCATCAACAGCAACA
CGATTTTCATTATCGCCTTCTCTCTTTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.930994
Expected error %
1.53686
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 97 E Value 6e-22 Identity 65.70% Align. Length 310bp (94.22%) Frame 2
hypothetical retrotransposon [Ipomoea batatas]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02206 Score 82 E Value 5e-15 Identity 17.10% Align. Length 227bp (69.00%) Frame 2
hypothetical protein - common tobacco retrotransposon Tto1 dbj|BAA11674.1| ORF(AA 1-1338) [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0111K24
Clone
Clone name
hba-111k24
LE_HBa0111K24
P111K24
Clone type
BAC
Contamination
none
Estimated length
121,171
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found