Clone Read LE_HBa0111M19_SP6_36324

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0111M19_SP6_36324
Primer
SP6
ID from Seq. Facility
LE_HBa_111_M19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
532 trimmed for vector and quality, 781 raw
Genbank Accession
Sequence
>LE_HBa0111M19_SP6_36324 (raw untrimmed)
ACTTGTTGTTCTGATATTTTCAGTACATCCAGCTGTGAGGGAGGGTATTGGAGATAATACAGAATTAAAGGAATAATTATATATGTTGATTAGTTAGTTA
GTTAGGAGTTAGTTAATTTGTTAATGAGTTAGTTGGGCTAGTTAGGAGTTAGTCAATACATTCCACATGTATATATAGTACCATACTTCATCTTTGTAAG
TCAGTTTTTCATATCTAAAAACCCATAAATTTCCCAAACTGATTTCTCTCTTCTACTCTGTTCATATTTGTTCAACCAAAACTGATTCTGAACATATATT
TTATTCCATTCAACTCCATATATAAAATTCAAGAATTTTTTCACATTCAACAAAATTCAAAGACATTACAAATCACTACTAATCATAAACTTTTTGAATC
CCACGTGATCAACTATGGACAGTGGATATTCATGCAAAATGATGGCATGAGCAAGTTCTCTTCTTGAAACGTCTTGATAAAAGTATTGTTGTTGGTTGCC
ATAATTCACTCCTGAATCACTCTCAGTTATAAAGTTAGTTGGTTTTCTGGTACATCTACGAAAATGTTCTAACATAGATGTTGTCCCACAATTTCTAGTC
GACTTGAAACCAGCATTACCATACCTACAAACCCTAAAACGCACACTATCAATCTTCCCTGGTTTAAAATGCTGCCAAAGCTTTTAAAAAAAATCATCTT
TGCTTGATTTTCGAAAACTTCATTATTTACTTCAATTGTTTTGTGAAGGGCATTTGACTCCTCCTTTTAAATACGAACAAT
>LE_HBa0111M19_SP6_36324 (trimmed for quality and cloning vector)
GAGGGAGGGTATTGGAGATAATACAGAATTAAAGGAATAATTATATATGTTGATTAGTTAGTTAGTTAGGAGTTAGTTAATTTGTTAATGAGTTAGTTGG
GCTAGTTAGGAGTTAGTCAATACATTCCACATGTATATATAGTACCATACTTCATCTTTGTAAGTCAGTTTTTCATATCTAAAAACCCATAAATTTCCCA
AACTGATTTCTCTCTTCTACTCTGTTCATATTTGTTCAACCAAAACTGATTCTGAACATATATTTTATTCCATTCAACTCCATATATAAAATTCAAGAAT
TTTTTCACATTCAACAAAATTCAAAGACATTACAAATCACTACTAATCATAAACTTTTTGAATCCCACGTGATCAACTATGGACAGTGGATATTCATGCA
AAATGATGGCATGAGCAAGTTCTCTTCTTGAAACGTCTTGATAAAAGTATTGTTGTTGGTTGCCATAATTCACTCCTGAATCACTCTCAGTTATAAAGTT
AGTTGGTTTTCTGGTACATCTACGAAAATGTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.927168
Expected error %
0.441799
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0111M19
Clone
Clone name
hba-111m19
LE_HBa0111M19
P111M19
Clone type
BAC
Contamination
none
Estimated length
88,464
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found